BBa_K1639008 1 BBa_K1639008 Tev Protease, single S219V mutation in the internal cleavage site 2015-09-12T11:00:00Z 2015-09-18T07:12:27Z Tobacco etch virus (TEV). TEV protease (also called Tobacco Etch Virus nuclear inclusion a endopeptidase) is a highly sequence-specific cysteine protease from Tobacco Etch Virus (TEV).The consensus for these native cut sites is ENLYFQ\S where ???\??? denotes the cleaved peptide bond. One of the main uses of this protein is for removing affinity tags from purified proteins. The reason for the use of TEV protease as a biochemical tool is its high sequence specificity. This specificity allows for the controlled cleavage of proteins when the preference sequence is inserted into flexible loops. It also makes it relatively non-toxic in vivo as the recognized sequence scarcely occurs in proteins.[1] false false _2056_ 24789 20835 9 false This part contains an additional BamHI restriction site at beginning of Tev Protease sequence and a XhoI restriction site at the end. false Mustafa Yılmaz annotation2453264 1 S219V range2453264 1 666 668 annotation2453252 1 ATG Start Codon range2453252 1 9 11 annotation2453253 1 Tev Protease range2453253 1 12 737 annotation2453254 1 Stop Codon range2453254 1 738 740 BBa_K1639008_sequence 1 gggatccgatgggcgagtcgctgttcaagggcccgcgtgactacaacccgatttcttctacgatttgtcatttgacaaatgaaagtgatggtcataccaccagcctctacggcattggattcggcccgtttattattacgaacaagcatttatttcgtcgtaataacggcaccctgctcgtgcaatcactccatggcgttttcaaagtcaaaaataccacgacccttcaacagcaccttattgatggtcgtgacatgatcattatccgcatgccgaaagactttccgccatttccgcagaagctcaagtttcgcgaacctcagcgcgaagaacgtatttgcttagtaactaccaattttcagactaaaagtatgagcagcatggtgtccgatacttcctgtacctttccatcatcagatggcattttttggaaacattggattcaaaccaaagacggtcagtgcggtagccctctggtatctacacgcgatggttttattgttggtattcatagcgcttcgaattttactaacaccaacaactactttacgtccgtgccaaaaaacttcatggaactgctgacaaaccaggaagcgcaacagtgggtctcaggttggcgtctgaatgcggattccgttttgtggggtggccacaaggtttttatggtgaaaccggaggaacctttccagccggtcaaggaagccacccagctgatgaatgaactggtgtatagccaataataactcgagt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z