BBa_K1639012 1 T7 express T7 expression system for pSB1C3 2015-09-14T11:00:00Z 2015-09-18T06:55:31Z It is combination of T7 promoter-terminator with sequences containing restriction enzyme cut sites. In our project we needed to express two different genes at the same bacteria, but unfortunately because of high repeats of sequences gene synthesizing company couldn't synthesize it. To solve this we just divided our genes into different plasmids and cotransformed it into same bacteria. For coexpression of genes from different plasmids origins have to be compatible, like ColA and ColE1. pSB1C3 possess ColE1 origin of replication. So it's compatible for expression with plasmid containg ColA origin of replication. But it doesn't contain expression machinery like promoters, terminators. We inserted this part to modify pSB1C3 so that it can be used as expression vector. false false _2056_ 20835 24789 9 true We inserted BamH1 and Sal1 cut sites between T7 promoter and T7 terminator. This part also contain RBS. Any other team can use this part to modify vectors like pSB1C3 to add T7 expression feature. Just clone it with enzymes at prefix and suffix. false Nurgeldi Bazarov annotation2457602 1 T7 promoter range2457602 1 1 19 annotation2457603 1 T7 bacteriophage RBS range2457603 1 35 57 annotation2457604 1 T7 terminator range2457604 1 124 171 BBa_K1639012_sequence 1 taatacgactcactatagggcctgtagaaataattttgtttaactttaagaaggagaggatccagcagcctgagacccgtcgactaataattaacctaggctgctgccaccgctgagcaataacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagctgaaaggaggaactata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z