BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986787 1 -10 range1986787 1 43 48 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_K1639022 1 BBa_K1639022 pCons-TetR-pTet-TevProtease Suicide Switch 2015-09-17T11:00:00Z 2015-09-18T10:18:35Z none This is a kill switch part of our engineering E. Coli. pTet is constitutively ON and repressed by TetR. TetR repression is inhibited by the addition of tetracycline or its analog, aTc. In the presence of aTc TetR repression inhibited and Tev Protease produce by Ptet promoter. Tev Protease release Pexiganan from DAMP and E. Coli kill switch works succesfully. false false _2056_ 20835 20835 9 false none false Mustafa Y&#305;lmaz component2472055 1 BBa_C0040 component2472056 1 BBa_R0040 component2472051 1 BBa_J23100 component2472065 1 BBa_K1639008 annotation2472055 1 BBa_C0040 range2472055 1 42 726 annotation2472065 1 BBa_K1639008 range2472065 1 797 1546 annotation2472051 1 BBa_J23100 range2472051 1 1 35 annotation2472056 1 BBa_R0040 range2472056 1 735 788 BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1639008 1 BBa_K1639008 Tev Protease, single S219V mutation in the internal cleavage site 2015-09-12T11:00:00Z 2015-09-18T07:12:27Z Tobacco etch virus (TEV). TEV protease (also called Tobacco Etch Virus nuclear inclusion a endopeptidase) is a highly sequence-specific cysteine protease from Tobacco Etch Virus (TEV).The consensus for these native cut sites is ENLYFQ\S where ???\??? denotes the cleaved peptide bond. One of the main uses of this protein is for removing affinity tags from purified proteins. The reason for the use of TEV protease as a biochemical tool is its high sequence specificity. This specificity allows for the controlled cleavage of proteins when the preference sequence is inserted into flexible loops. It also makes it relatively non-toxic in vivo as the recognized sequence scarcely occurs in proteins.[1] false false _2056_ 24789 20835 9 false This part contains an additional BamHI restriction site at beginning of Tev Protease sequence and a XhoI restriction site at the end. false Mustafa Y&#305;lmaz annotation2453252 1 ATG Start Codon range2453252 1 9 11 annotation2453253 1 Tev Protease range2453253 1 12 737 annotation2453264 1 S219V range2453264 1 666 668 annotation2453254 1 Stop Codon range2453254 1 738 740 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation2213989 1 Help:Barcodes range2213989 1 661 685 annotation23330 1 SsrA range23330 1 621 654 BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1639022_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagtccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagaggggatccgatgggcgagtcgctgttcaagggcccgcgtgactacaacccgatttcttctacgatttgtcatttgacaaatgaaagtgatggtcataccaccagcctctacggcattggattcggcccgtttattattacgaacaagcatttatttcgtcgtaataacggcaccctgctcgtgcaatcactccatggcgttttcaaagtcaaaaataccacgacccttcaacagcaccttattgatggtcgtgacatgatcattatccgcatgccgaaagactttccgccatttccgcagaagctcaagtttcgcgaacctcagcgcgaagaacgtatttgcttagtaactaccaattttcagactaaaagtatgagcagcatggtgtccgatacttcctgtacctttccatcatcagatggcattttttggaaacattggattcaaaccaaagacggtcagtgcggtagccctctggtatctacacgcgatggttttattgttggtattcatagcgcttcgaattttactaacaccaacaactactttacgtccgtgccaaaaaacttcatggaactgctgacaaaccaggaagcgcaacagtgggtctcaggttggcgtctgaatgcggattccgttttgtggggtggccacaaggtttttatggtgaaaccggaggaacctttccagccggtcaaggaagccacccagctgatgaatgaactggtgtatagccaataataactcgagt BBa_K1639008_sequence 1 gggatccgatgggcgagtcgctgttcaagggcccgcgtgactacaacccgatttcttctacgatttgtcatttgacaaatgaaagtgatggtcataccaccagcctctacggcattggattcggcccgtttattattacgaacaagcatttatttcgtcgtaataacggcaccctgctcgtgcaatcactccatggcgttttcaaagtcaaaaataccacgacccttcaacagcaccttattgatggtcgtgacatgatcattatccgcatgccgaaagactttccgccatttccgcagaagctcaagtttcgcgaacctcagcgcgaagaacgtatttgcttagtaactaccaattttcagactaaaagtatgagcagcatggtgtccgatacttcctgtacctttccatcatcagatggcattttttggaaacattggattcaaaccaaagacggtcagtgcggtagccctctggtatctacacgcgatggttttattgttggtattcatagcgcttcgaattttactaacaccaacaactactttacgtccgtgccaaaaaacttcatggaactgctgacaaaccaggaagcgcaacagtgggtctcaggttggcgtctgaatgcggattccgttttgtggggtggccacaaggtttttatggtgaaaccggaggaacctttccagccggtcaaggaagccacccagctgatgaatgaactggtgtatagccaataataactcgagt BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z