BBa_K1639024 1 BBa_K1639024 Toehold riboregulator without reporter 2015-09-17T11:00:00Z 2015-09-21T04:46:08Z Labaroty engineered Toehold riboregulator is syntheticaly produced RNA molecule which designed complementary to trigger RNA (BBa_K1639001) This part is composed of approximately 100 nt RNA molecule. It's 30 nt is completely complementary to BBa_K1639001. Together they constitute AND logic gate part of our project. It's a new and flexible approach to AND gate switches because of sequence variablity and ease of modification. false false _2056_ 24789 24789 9 false 30 nt (87-116bp) in 3' end of molecule is very critical to function properly. We noticed it in features. false Nurgeldi Bazarov annotation2474475 1 21 nt linker range2474475 1 87 107 annotation2474496 1 GFP-9nt range2474496 1 108 116 annotation2474470 1 T7 range2474470 1 1 19 annotation2474471 1 Toehold-RNA range2474471 1 20 107 annotation2474525 1 ATG range2474525 1 75 77 annotation2474473 1 Conserved region range2474473 1 87 116 annotation2474472 1 RBS range2474472 1 61 68 BBa_K1639024_sequence 1 taatacgactcactatagggtcttatcttatctatctcgtttatccctgcatacagaaacagaggagatatgcaatgataaacgagaacctggcggcagcgcaaaagatgcgtaaaggatcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z