BBa_K1641010 1 BBa_K1641010 Rox, recognition site of recombinase Dre 2015-09-09T11:00:00Z 2015-09-10T12:43:19Z By de novo synthesis. This is the recognition site of Cre-like recombinase Dre, that is "TAACTTTAAATAATTGGCATTATTTAAAGTTA". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without cutting activity and start code. with This deletion do not interfere the usage of the brick. false false _2058_ 20036 20036 9 false Vox do not process start coding ATG, so the original Rox sequence just works fine. false Pai Li BBa_K1641010_sequence 1 taactttaaataattggcattatttaaagtta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z