BBa_K1641011 1 BBa_K1641011 Vox, recognition site of recombinase Vika 2015-09-09T11:00:00Z 2015-09-10T12:25:04Z By de novo synthesis. This is the recognition site of Cre-like recombinase Vika, that is "AATAGGTCTGAGAACGCCCATTCTCAGACGTATT". This recognition site is not homologous with LoxP and hence will not cross-react with Cre or other common recombinases. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. This deletion do not interfere the usage of the brick. false false _2058_ 20036 20036 9 false Vox, as the RTS of Vika, do not process ATG as unexpected start code, so the original false Pai Li BBa_K1641011_sequence 1 aataggtctgagaacgcccattctcagacgtatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z