BBa_K1641015 1 BBa_K1641015 Up-side-down RBS::mcherry-ssra with FRT recognition sites 2015-09-09T11:00:00Z 2015-09-10T08:03:56Z This part is constructed by PCR from biobricks or cut-and-link. This is a special RBS::mcherry-ssra inverted into up-side-down form, with two FRT sites at the upstream and downstream of the gene. FRT can be recognized and the middle sequence can be restored by invertase Flp. Ssra-tag in this sequence is moderately fast type (BBa_M0052) that accelerates the degradation but at a speed far less than expression. This part can be used to construct the reporter for real-time invertase dynamics analysis. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without start code and restriction enzyme activity. This sequence is absolutely compatible with brick construction method and usually less likely to make trouble. false false _2058_ 20036 20036 9 false This sequence is up-side-down, hence can be inverted into normal sequence. false Pai Li annotation2448581 1 inverted mcherry-ssra range2448581 1 44 787 annotation2448583 1 B0034 range2448583 1 794 805 annotation2448584 1 FRT range2448584 1 812 845 annotation2448576 1 FRT range2448576 1 1 34 BBa_K1641015_sequence 1 gaagttcctatactttttagagaataggaacttcactagattattaagaagcgtcagcgtagttttcgtcgttagcagccttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtgaagttcctattctctaaaaagtataggaacttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z