BBa_K1641022 1 BBa_K1641022 Up-side-down RBS::mcherry with LoxP, recognition site of Cre 2015-09-10T11:00:00Z 2015-09-11T10:46:02Z This part is constructed by PCR or cut-and-link of biobricks. No sequence comes from risky organism in need of special attention. This is a special RBS::mcherry inverted into up-side-down form, with two LoxP sites at the upstream and downstream of the gene. LoxP can be recognized and the middle sequence can be restored by invertase Cre. There is no ssra tag and this mcherry, if expressed, is very stable. This part can be used to construct the reporter for real-time invertase dynamics analysis. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without start code and restriction enzyme activity. This sequence is absolutely compatible with brick construction method and usually less likely to make trouble. false false _2058_ 20036 20036 9 false This sequence is up-side-down, hence can be inverted into normal sequence. false Pai Li BBa_K1641022_sequence 1 ataacttcgtatagcatacattatacgaagttatactagattattacttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtataacttcgtataatgtatgctatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z