BBa_K1641024 1 BBa_K1641024 Reporter of Invertase activity of Cre, pInv-rep-100LoxM 2015-09-09T11:00:00Z 2015-09-12T03:51:10Z All of the parts come from biobricks. This is the reporter of inversion activity of invertase Cre. An up-side-down mcherry gene with RBS is surrounded by a pair of LoxP and controlled by a constructive promoter BBa_J23101. At first stage, due to the meaningless mRNA, red signal cannot be generated, but when Cre exist,it inverts and restore the mcherry gene between two LoxP, the red signal can be generated at once. This device is constructed to measure the real-time dynamics of timing module of Cre in the Micro-timer presented by SYSU-CHINA. false false _2058_ 20036 20036 9 In stock false We aim to construct a real-timer detector of invertase dynamics, which must be quantifiable. Hence, using mcherry, one of the best fluorescence signal, we can supervise the RFU of a strain and precisely simulate the exact situation of each invertase timing module. The data can be valuable for modeling work and the inversion time of corresponding module can be calculated. false Pai Li component2448535 1 BBa_J23101 annotation2448535 1 BBa_J23101 range2448535 1 1 35 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1641024_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z