BBa_K1641015 1 BBa_K1641015 Up-side-down RBS::mcherry-ssra with FRT recognition sites 2015-09-09T11:00:00Z 2015-09-10T08:03:56Z This part is constructed by PCR from biobricks or cut-and-link. This is a special RBS::mcherry-ssra inverted into up-side-down form, with two FRT sites at the upstream and downstream of the gene. FRT can be recognized and the middle sequence can be restored by invertase Flp. Ssra-tag in this sequence is moderately fast type (BBa_M0052) that accelerates the degradation but at a speed far less than expression. This part can be used to construct the reporter for real-time invertase dynamics analysis. Note: The brick sequence starts directly after the XbaI of prefix and ends before SpeI of the Suffix, without the useless bases (G and T respectively) added before and after brick sequence. The scar will be "ACTAGA" safely without start code and restriction enzyme activity. This sequence is absolutely compatible with brick construction method and usually less likely to make trouble. false false _2058_ 20036 20036 9 false This sequence is up-side-down, hence can be inverted into normal sequence. false Pai Li annotation2448583 1 B0034 range2448583 1 794 805 annotation2448584 1 FRT range2448584 1 812 845 annotation2448576 1 FRT range2448576 1 1 34 annotation2448581 1 inverted mcherry-ssra range2448581 1 44 787 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1641028 1 BBa_K1641028 Reporter of Invertase activity of Flp, pInv-rep-101FRTM 2015-09-11T11:00:00Z 2015-09-12T05:48:59Z This brick is constructed through cut-and-link of other bricks, without risky sources. This is a reporter of invertase activity of Cre for Real-time measurement of dynamics of timing modules by SYSU-CHINA 2015. false false _2058_ 20036 20036 9 false All reporter is constructed as following pattern: Constructive promoter :: RTS :: up-side-down RBS-mcherry-(ssra) :: RTS :: terminator false Pai Li component2452555 1 BBa_J23101 component2452567 1 BBa_B0015 component2452560 1 BBa_K1641015 annotation2452567 1 BBa_B0015 range2452567 1 897 1025 annotation2452555 1 BBa_J23101 range2452555 1 1 35 annotation2452560 1 BBa_K1641015 range2452560 1 44 888 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1641015_sequence 1 gaagttcctatactttttagagaataggaacttcactagattattaagaagcgtcagcgtagttttcgtcgttagcagccttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtgaagttcctattctctaaaaagtataggaacttc BBa_K1641028_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagaggaagttcctatactttttagagaataggaacttcactagattattaagaagcgtcagcgtagttttcgtcgttagcagccttgtacagctcgtccatgccgccggtggagtggcggccctcggcgcgttcgtactgttccacgatggtgtagtcctcgttgtgggaggtgatgtccaacttgatgttgacgttgtaggcgccgggcagctgcacgggcttcttggccttgtaggtggtcttgacctcagcgtcgtagtggccgccgtccttcagcttcagcctctgcttgatctcgcccttcagggcgccgtcctcggggtacatccgctcggaggaggcctcccagcccatggtcttcttctgcattacggggccgtcggaggggaagttggtgccgcgcagcttcaccttgtagatgaactcgccgtcctgcaaggaggagtcctgggtcacggtcaccacgccgccgtcctcgaagttcatcacgcgctcccacttgaagccctcggggaaggacagcttcaagtagtcggggatgtcggcggggtgcttcacgtaggccttggagccgtacatgaactgaggggacaggatgtcccaggcgaagggcagggggccacccttggtcaccttcagcttggcggtctgggtgccctcgtaggggcggccctcgccctcgccctcgatctcgaactcgtggccgttcacggagccctccatgtgcaccttgaagcgcatgaactccttgatgatggccatgttatcctcctcgcccttgctcaccattctagttttctcctcttttctagtgaagttcctattctctaaaaagtataggaacttctactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z