BBa_K1641219 1 BBa_K1641219 Standard for qPCR 2015-09-12T11:00:00Z 2015-09-14T09:04:53Z Artificial. Reversed BBa_J61046. false false _2058_ 23346 23346 9 false For Cre recombinase. false Jianheng Liu BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_K1641200 1 BBa_K1641200 pBAD(forward)-FRT(forward)-LoxP(reverse) 2015-09-12T11:00:00Z 2015-09-13T06:27:34Z Sequence was synthetized by IDT. pBAD forward promoter+recombinase Flpe recognition site (forward)+recombinase Cre recognition site (reverse). Used in iGEM15_SYSU_China project. false false _2058_ 23346 23346 9 false This sequence has two primer sites and a restriction enzyme site between FRT and loxP for further testing in our experiment. Two primers are: GCACCTTGACTCTGACAATCCT (forward) GCCTGTGCTAATGGTGATGACT (reverse) they both have a high annealing temperature (about 58C). They can be used as qPCR primers. The restriction enzyme sites are HindIII and BanI false Jianheng Liu component2453177 1 BBa_J61020 component2453178 1 BBa_K1641219 component2453176 1 BBa_I13453 annotation2453176 1 BBa_I13453 range2453176 1 1 130 annotation2453178 1 BBa_K1641219 range2453178 1 181 214 annotation2453177 1 BBa_J61020 range2453177 1 139 172 BBa_J61020 1 FRT [FRT] 2006-09-20T11:00:00Z 2015-08-31T02:02:59Z <tt> Extend ca1010F/R (73 bp, EcoRI/SpeI)<br> Sub into pSB1A2-I13522 (EcoRI/SpeI)<br> Product is pSB1A2-Bca1010<br> ---- ca1010F Forward (universal biobrick) EcoRI for FRT<br> GGACTgaattcgcggccgcttctagag<br> ca1010R Reverse SpeI oligo for FRT<br> cctatactagtagaagttcctattctctaAaaagtataggaacttcctctagaagcggccgcg<br> </tt> Site for recombination by flp recombinase. Genes flanked by FRT sites (oriented in the same direction) in the genome can be excised with the introduction of flp recombinase-expressing helper plasmid pCP20. Note that the original FRT sequence contained an XbaI site that has been removed with a point mutation for compatibility with standard assembly. See Datsenko and Wanner for details of its use in markerless knockouts and knockins. false false _95_ 0 483 95 It's complicated false N/A false John Anderson BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_K1641219_sequence 1 gcaccttgactctgacaatcctttacaatggacaaaaacatcaatctgatatcactgatattgtaagtagtttgcaattacagttcgaatcatcggaagaagcagataagggaaatagccacagtcatcaccattagcacaggc BBa_J61020_sequence 1 gaagttcctatactttttagagaataggaacttc BBa_K1641200_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagaggaagttcctatactttttagagaataggaacttctactagagataacttcgtataatgtatgctatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z