BBa_K1641215 1 BBa_K1641215 pBAD(forward)-FRT(forward) 2015-09-13T11:00:00Z 2015-09-14T09:50:39Z false false _2058_ 23346 23346 9 false false Jianheng Liu component2454705 1 BBa_I13453 component2454706 1 BBa_J61020 annotation2454705 1 BBa_I13453 range2454705 1 1 130 annotation2454706 1 BBa_J61020 range2454706 1 139 172 BBa_I13453 1 BBa_I13453 Pbad promoter 2005-05-24T11:00:00Z 2015-08-31T04:07:34Z Released HQ 2013 PBad promoter from I0500 without AraC. false false _11_ 0 253 6 In stock false true jkm BBa_J61020 1 FRT [FRT] 2006-09-20T11:00:00Z 2015-08-31T02:02:59Z <tt> Extend ca1010F/R (73 bp, EcoRI/SpeI)<br> Sub into pSB1A2-I13522 (EcoRI/SpeI)<br> Product is pSB1A2-Bca1010<br> ---- ca1010F Forward (universal biobrick) EcoRI for FRT<br> GGACTgaattcgcggccgcttctagag<br> ca1010R Reverse SpeI oligo for FRT<br> cctatactagtagaagttcctattctctaAaaagtataggaacttcctctagaagcggccgcg<br> </tt> Site for recombination by flp recombinase. Genes flanked by FRT sites (oriented in the same direction) in the genome can be excised with the introduction of flp recombinase-expressing helper plasmid pCP20. Note that the original FRT sequence contained an XbaI site that has been removed with a point mutation for compatibility with standard assembly. See Datsenko and Wanner for details of its use in markerless knockouts and knockins. false false _95_ 0 483 95 It's complicated false N/A false John Anderson BBa_I13453_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagc BBa_J61020_sequence 1 gaagttcctatactttttagagaataggaacttc BBa_K1641215_sequence 1 acattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccataccgtttttttgggctagctactagaggaagttcctatactttttagagaataggaacttc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z