BBa_K1641221 1 BBa_K1641221 FRT(reverse)-loxP(forward) 2015-09-13T11:00:00Z 2015-09-14T08:41:14Z false false _2058_ 23346 23346 9 false This sequence has two primer sites between FRT and loxP for further testing in our experiment. Two primers are: GCACCTTGACTCTGACAATCCT (forward) GCCTGTGCTAATGGTGATGACT (reverse) they both have a high annealing temperature (about 58C). They can be used as qPCR primers. false Jianheng Liu BBa_K1641221_sequence 1 gaagttcctattctctaaaaagtataggaacttctactagagagtcatcaccattagcacaggcggggtaccccgcaccttgactctgacaatccttactagagataacttcgtatagcatacattatacgaagttat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z