BBa_K1643023 1 BBa_K1643023 gRNA-A 2015-09-17T11:00:00Z 2015-09-18T07:27:10Z TAGAATTGATCAGAGGAACG It is used as gRNA. Xba I and Spe I were added to the upstream and downstream sequence to be compatible with the basic backbone. false false _2060_ 24786 24786 9 false No false Zhiyang Shi igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z