BBa_K1645998 1 BBa_K1645998 SgRNA targeting LacI promoter 2015-09-17T11:00:00Z 2015-09-21T11:50:48Z The scaffold sequence was obtained from gRNA design protocol from Church Lab. Link is provided below: https://www.addgene.org/static/cms/files/hCRISPR_gRNA_Synthesis.pdf This part contains the 20 nucleotides long sequence which is complimentary to the region within the LacI (BBa_R0010) promoter, the scaffold region which is responsible for the secondary structure of the SgRNA, and the terminator. A constitutive promoter can should be placed upstream of this SgRNA in order for it to get transcribed.The suggested promoter to be used for this part is the U6 promoter. false false _2062_ 18334 18367 9 false This part was cloned without the promoter to avoid the biobrick illegal site existing on the U6 promoter. You can refer Waterloo iGEM 2015 wiki to see the full sequence of the U6 promoter in order to clone it in. The characterization data using this part in our purposes suggests that our CRISPR cas9 system is working using this SgRNA by suppressing RFP which uses lacI promoter. Our experiment was done in BL21 and the SgRNA was in pSB3K3 backbone containing part BBa-K1645999. We were able to detect drop in RFP levels using this SgRNA coupled by S.pyrogenes dCas9. false Peivand Sadat Mousavi annotation2469078 1 BBa_B0010 range2469078 1 1 80 annotation2469079 1 stem_loop range2469079 1 12 55 BBa_K1645998_sequence 1 ggcacgacaggtttcccgacgttttagagctagaaatagcaagttaaaataaggctagtccgttatcaacttgaaaaagtggcaccgagtcggtgctttttttccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z