BBa_K1647012 1 BBa_K1647012 PompC+taRNA+B0010 2015-09-14T11:00:00Z 2015-09-17T05:51:24Z None for the moment None for the moment false false _2064_ 28136 8598 9 false None for the moment false Zhixiong Xie component2460070 1 BBa_J01086 component2460071 1 BBa_B0010 component2460069 1 BBa_R0082 annotation2460070 1 BBa_J01086 range2460070 1 117 210 annotation2460071 1 BBa_B0010 range2460071 1 219 298 annotation2460069 1 BBa_R0082 range2460069 1 1 108 BBa_R0082 1 OmpR Promoter (OmpR, positive) 2004-01-27T12:00:00Z 2015-05-08T01:14:15Z NC_000193 E. coli K12 Released HQ 2013 Positively regulated, OmpR-controlled promoter. This promoter is taken from the upstream region of ompC. Phosphorylated OmpR binds to the three operator sites and activates transcription. false false _1_ 0 24 7 In stock false The promoter includes the three OmpR binding sites: C1, C2, and C3. The promoter starts at -107 and goes up to the transcriptional start site at +1. An alternate version, BBa_R0083, cuts out the C2 and C3 sites. The efficacy of this promoter versus the truncated ompC upstream region (BBa_R0083) or the ompF upstream region (BBa_R0084) is currently unknown. true Stephen Lee, Roshan Kumar, Joe Levine, Ziyan Chu (Polkadorks, IAP 2004) annotation301167 1 -10 range301167 1 98 103 annotation301155 1 C2 OmpR range301155 1 34 51 annotation301154 1 C1 OmpR range301154 1 13 30 annotation301156 1 C3 OmpR range301156 1 54 71 annotation301166 1 -35 range301166 1 75 80 BBa_J01086 1 Key3 Key3 2005-11-29T12:00:00Z 2015-08-31T04:08:12Z -- No description -- false false _13_ 0 395 13 In stock false false Golden Bear BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_R0082_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggact BBa_K1647012_sequence 1 tcccttgcatttacattttgaaacatctatagcgataaatgaaacatcttaaaagttttagtatcatattcgtgttggattattctgcatttttggggagaatggacttactagagacccaaaagcaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctttactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J01086_sequence 1 acccaaaagcaggaggtgaatctagtaggtggttaatgaaaattaacttacttactagaaatatctctaaaaagccagattattaatccggctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z