BBa_K1647016 1 BBa_K1647016 CAP 2015-09-14T11:00:00Z 2015-09-17T05:57:45Z None for the moment CAP is a short peptide derived from the competence stimulating peptide(CSP) which can anchor the receptor on the S.mutans membrane. The CAP can be used as a antimicrobial targeting domain to mediate S.mutans-specific delivery of an antimicrobial peptide domain as a result in enriching the antimicrobial peptide around the S.mutans in order to kill the bacteria selectively. false false _2064_ 28136 28136 9 false To reduce the effect of the CAP on the Bac8c, the CAP only has the least effective sequence of the CSP. false Yun Xue BBa_K1647016_sequence 1 atgaccttttttcgtctgtttaatcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z