BBa_K1647018 1 BBa_K1647018 CAP-Bac8c, an improved antimicrobial peptide selectively 2015-09-14T11:00:00Z 2016-02-01T12:50:26Z None for the moment The CAP is a short peptide derived from the competence stimulation peptide(CSP) which can binding to the receptors on the membrane of the S.mutans selectively. The Bac8c is the strong antimicrobial peptide which can kill the bacterial effectively. The part is a new improved peptide ,based on the fusion of a S.mutans-specific targeting peptide domain with a wide-spectrum antimicrobial peptide domain ,which can restrain even kill the S.mutans specifically. false false _2064_ 4206 28136 9 false To reduce the effect of the CAP on the Bac8c, the CAP only has the least effective sequence of the CSP. Besides, we design an intersequence ,GGG, put between the CAP and Bac8c for the same goal. false Yun Xue component2458054 1 BBa_K1647017 component2458053 1 BBa_K1647016 annotation2458054 1 BBa_K1647017 range2458054 1 35 64 annotation2458053 1 BBa_K1647016 range2458053 1 1 28 BBa_K1647016 1 BBa_K1647016 CAP 2015-09-14T11:00:00Z 2015-09-17T05:57:45Z None for the moment CAP is a short peptide derived from the competence stimulating peptide(CSP) which can anchor the receptor on the S.mutans membrane. The CAP can be used as a antimicrobial targeting domain to mediate S.mutans-specific delivery of an antimicrobial peptide domain as a result in enriching the antimicrobial peptide around the S.mutans in order to kill the bacteria selectively. false false _2064_ 28136 28136 9 false To reduce the effect of the CAP on the Bac8c, the CAP only has the least effective sequence of the CSP. false Yun Xue BBa_K1647017 1 BBa_K1647017 Bac8c,a kind of antimicrobial peptides 2015-09-14T11:00:00Z 2016-01-28T12:08:17Z None for the moment The antimicrobial peptide, Bac8c, has a potential clinical application in preventing and treating dental caries. S.mutans treated with Bac8c shows abundance effect on bacterial structure. There appears to be a large amount of extracellular debris and obvious holes on the cell surface, as well as loss of cell wall and nucleoid condensation. What???s more, Bac8c can remarkably reduce the viability of cells in biofilms formed in the BioFlux system. false false _2064_ 4206 28136 9 false None false Yun Xue BBa_K1647017_sequence 1 atgcgtcgttggattgtttggattcgttaa BBa_K1647018_sequence 1 atgaccttttttcgtctgtttaatcgtttactagatgcgtcgttggattgtttggattcgttaa BBa_K1647016_sequence 1 atgaccttttttcgtctgtttaatcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z