BBa_K1647020 1 BBa_K1647020 AAP2, a kind of antimicrobial peptides 2015-09-14T11:00:00Z 2016-01-28T12:08:34Z None for the moment The antimicrobial peptide, APP2, can achieve high activity exclusively at low environmental pH to target bacterial species like Streptococcus mutans that produce acid and thrive under the low pH conditions detrimental for tooth integrity. However, at pH 7.5, it has no effect on cell viability. There are only six histidine(His) and eight phenylalanine(Phe) residues present in the APP2. The pH-responsiveness of APP2 has been attributed to the presence of multiple His which enable the conformational flexibility necessary to transition from the less effective more general membrane disruptive α-helical form at close to neutral pH to its substantially more active random coil conformation at low pH. The hydrophobicity necessary for membrane interaction is provided by Phe groups which in contrast to other hydrophobic amino acids allow for the conformational flexibility needed for the pH-dependent antimicrobial activity of APP2. false false _2064_ 4206 28136 9 false None false Yun Xue BBa_K1647016 1 BBa_K1647016 CAP 2015-09-14T11:00:00Z 2015-09-17T05:57:45Z None for the moment CAP is a short peptide derived from the competence stimulating peptide(CSP) which can anchor the receptor on the S.mutans membrane. The CAP can be used as a antimicrobial targeting domain to mediate S.mutans-specific delivery of an antimicrobial peptide domain as a result in enriching the antimicrobial peptide around the S.mutans in order to kill the bacteria selectively. false false _2064_ 28136 28136 9 false To reduce the effect of the CAP on the Bac8c, the CAP only has the least effective sequence of the CSP. false Yun Xue BBa_K1647019 1 BBa_K1647019 Cap-AAP2, a improved antimicrobial peptide which can kill the S.mutans selectively and have changeab 2015-09-14T11:00:00Z 2015-09-18T10:55:39Z None for the moment The CAP is a short peptide derived from the competence stimulation peptide(CSP) which can binding to the receptors on the membrane of the S.mutans selectively. APP2 , a antimicrobial peptide, can achieve high activity exclusively at low environmental pH to target bacterial species like Streptococcus mutans that produce acid and thrive under the low pH conditions detrimental for tooth integrity. However, at pH 7.5, it has no effect on cell viability. The part is a new improved peptide ,based on the fusion of a S.mutans-specific targeting peptide domain with a special antimicrobial peptide domain which has strong antibacterial ability at acid environment ,however , weakly at neural pH ,which can restrain and even kill the S.mutans specifically as well as have weak effect on other bacteria at neural and base pH. false false _2064_ 28136 28136 9 false To reduce the effect of the CAP on the Bac8c, the CAP only has the least effective sequence of the CSP. Besides, we design an intersequence ,GGG, put between the CAP and Bac8c for the same goal. false Yun Xue component2458056 1 BBa_K1647020 component2458055 1 BBa_K1647016 annotation2458056 1 BBa_K1647020 range2458056 1 35 82 annotation2458055 1 BBa_K1647016 range2458055 1 1 28 BBa_K1647019_sequence 1 atgaccttttttcgtctgtttaatcgtttactagatgttccatcatttcttccatttcttccatcatttcttccatttttaa BBa_K1647020_sequence 1 atgttccatcatttcttccatttcttccatcatttcttccatttttaa BBa_K1647016_sequence 1 atgaccttttttcgtctgtttaatcgtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z