BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916610 1 BBa_B0010 range1916610 1 1 80 annotation1916612 1 BBa_B0012 range1916612 1 89 129 BBa_K1648000 1 BBa_K1648000 Recombination Template for mamAB Operon 2015-07-06T11:00:00Z 2015-07-25T12:43:34Z Magnetospirillum gryphiswaldense MSR-1 v2, complete genome This part is constructed by four fragments from the magnetospirillum gryphiswaldense magnetosome island, and it is to be used to do the homologous recombination with the genomic DNA of the magnetospirillum to form the whole coding sequence of false false _2065_ 13322 26823 9 Not in stock false In order to form a homologous recombination template, we select 250 bp of each fragment and do the overlapping PCR ligate fragments together. false Leung King Pong annotation2433092 1 mamO 5' flanking sequence range2433092 1 521 770 annotation2433091 1 mamN 3' flanking sequence range2433091 1 251 500 annotation2433090 1 mamH 5' flanking sequence range2433090 1 1 250 annotation2433093 1 mamU 3' flanking sequence range2433093 1 771 1020 BBa_K1648002 1 BBa_K1648002 Recombination Template for mamAB Operon with Promotor and Terminator 2015-07-15T11:00:00Z 2015-09-16T08:39:46Z Magnetospirillum gryphiswaldense MSR-1 v2, complete genome Consist of a template for recombination of mamAB operon(K1648000), a template for recombination of mamXY, mamGC and mms operon(K1648001), a promotor & RBS(J13002) in front of each template and a double terminator(B0015) at the back of each template. This part is designed for homologous recombination to introduce the large magnetosome forming operon into Azotobactor vinelandii. This part is introduced into A. vinelandii genome via random integration before full operon sequences to be transformed into A. vinelandii. false false _2065_ 26823 26823 9 false We add a promotor and RBS before each template to initial the coding and a double terminator(B0015) behind each template to terminate the coding and ligate these parts together. false Leung King Pong component2463313 1 BBa_J13002 component2463325 1 BBa_B0015 component2463318 1 BBa_K1648000 annotation2463313 1 BBa_J13002 range2463313 1 1 74 annotation2463318 1 BBa_K1648000 range2463318 1 81 1100 annotation2463325 1 BBa_B0015 range2463325 1 1109 1237 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J13002 1 BBa_J13002 TetR repressed POPS/RIPS generator 2005-06-15T11:00:00Z 2015-08-31T04:08:29Z Released HQ 2013 -- No description -- false true _37_5_ 0 88 37 In stock false true Jeff Tabor component1535786 1 BBa_B0034 component1535778 1 BBa_R0040 annotation1535778 1 BBa_R0040 range1535778 1 1 54 annotation1535786 1 BBa_B0034 range1535786 1 63 74 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_K1648000_sequence 1 atgacgggaatggaacctggcagatcagaagttgaggggcaccagcgcaacgccctttatttattgtcggcgttgtgcatggttttcatgactctcgtcgttgctattcagccgctttttttgcgaaacgttcttaatatccccttcgagactgccggggcagtcaatgccaatgtgcaggtggtgaccgaggtccttgatcttttcatctttgcctatcttggttacctgtcagatcgcattggccgggtggacaggcggcttggtgggcgctggcccttggcatcatggccggctcgtgtgccgcgctatcgggcgccaccgccggtgcgttggccatgaaccaatattccggcttcgtgaagcggcacccggaattggcttcggctgccgccgcgggattgcaattcacccatcgggaatatgtccgttggggattgccgctgatggggatttttttggtgttgtcgaccgtgtacatcgccgttctcgcaggatgaccgatgacgacaggaactcgatgattgaaattggcgagaccatgggtgatcagcccaccaacaaaatcgtcttttgcgagcggtcgtggaaagcgcctgtctccatcctggcgttcctgatcctagtgactttcgcctggggggcctatctcctcgacaactacgacgaggacgactacttccgtggtagcgacgatatgtcggtcggccaattcctggtccgcaacgtcgccatgcctgatgtgcagcggctgtactatacagtaccactggcggatccctgggggtttatgtggggcgcagcgccggaccggtcgggctcatggaattgggacttcaggccgctatggggcggtgggccagcaacgaagccttgttccagggtgagatgcactggctggaggttcaaaccgaacagcgcaagccgctgatttccattgatggcgaggtggagaaaatggaaggtcccttccgcttcgacattctgcccggagcgctttccatactggttccgaaataa BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_J13002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K1648002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgacgggaatggaacctggcagatcagaagttgaggggcaccagcgcaacgccctttatttattgtcggcgttgtgcatggttttcatgactctcgtcgttgctattcagccgctttttttgcgaaacgttcttaatatccccttcgagactgccggggcagtcaatgccaatgtgcaggtggtgaccgaggtccttgatcttttcatctttgcctatcttggttacctgtcagatcgcattggccgggtggacaggcggcttggtgggcgctggcccttggcatcatggccggctcgtgtgccgcgctatcgggcgccaccgccggtgcgttggccatgaaccaatattccggcttcgtgaagcggcacccggaattggcttcggctgccgccgcgggattgcaattcacccatcgggaatatgtccgttggggattgccgctgatggggatttttttggtgttgtcgaccgtgtacatcgccgttctcgcaggatgaccgatgacgacaggaactcgatgattgaaattggcgagaccatgggtgatcagcccaccaacaaaatcgtcttttgcgagcggtcgtggaaagcgcctgtctccatcctggcgttcctgatcctagtgactttcgcctggggggcctatctcctcgacaactacgacgaggacgactacttccgtggtagcgacgatatgtcggtcggccaattcctggtccgcaacgtcgccatgcctgatgtgcagcggctgtactatacagtaccactggcggatccctgggggtttatgtggggcgcagcgccggaccggtcgggctcatggaattgggacttcaggccgctatggggcggtgggccagcaacgaagccttgttccagggtgagatgcactggctggaggttcaaaccgaacagcgcaagccgctgatttccattgatggcgaggtggagaaaatggaaggtcccttccgcttcgacattctgcccggagcgctttccatactggttccgaaataatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z