BBa_K1648006 1 BBa_K1648006 Insertion kit with GFP-nanobody 2015-09-15T11:00:00Z 2015-09-23T11:24:12Z Magnetospirillum gryphiswaldense MSR-1 v2, complete genome It contains a Consist of a genome (mamC) from magnetosome island of Magnetospirillum gryphiswaldense genome and GFP nanobody in order to fuse GFP nanobody to the membrane of magnetosome. false false _2065_ 26823 26823 9 false It contains a Consist of a genome (mamC) from magnetosome island of Magnetospirillum gryphiswaldense genome and GFP nanobody in order to fuse GFP nanobody to the membrane of magnetosome. false Leung King Pong annotation2477141 1 BBa_B0010 range2477141 1 820 899 annotation2477135 1 conserved range2477135 1 67 70 annotation2477138 1 BBa_K1648005 range2477138 1 464 811 annotation2477144 1 T7 TE range2477144 1 915 934 annotation2477137 1 mamC range2477137 1 81 455 annotation2477142 1 stem_loop range2477142 1 831 874 annotation2477140 1 BBa_B0015 range2477140 1 820 948 annotation2477145 1 polya range2477145 1 935 948 annotation2477131 1 -35 range2477131 1 20 25 annotation2477134 1 BBa_B0034 range2477134 1 63 74 annotation2477143 1 BBa_B0012 range2477143 1 908 948 annotation2477133 1 -10 range2477133 1 43 48 annotation2477136 1 BBa_K1648007 range2477136 1 81 455 annotation2477139 1 GFP nanobody range2477139 1 464 811 annotation2477132 1 TetR 2 range2477132 1 26 44 BBa_K1648006_sequence 1 caggtgcagctggtggaatctggtggtgccctggtgcagcctggcggctctctgagactgtcttgtgccgcctctggcttccccgtgaacagatactccatgcggtggtacagacaggcccctggcaaagaacgcgagtgggtggccggaatgtcctccgctggcgacagatcctcctacgaggactccgtgaagggccggttcaccatctctcgggacgacgccagaaacaccgtgtacctccagatgaactccctgaagcccgaggacaccgccgtgtactactgcaacgtgaacgtgggcttcgagtactggggccagggcacacaagtgaccgtgtcctctaag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z