BBa_K165032 1 BBa_K165032 mCYC promoter plus Gli1 binding sites 2008-10-28T12:00:00Z 2015-05-08T01:10:56Z Composite part that was taken via PCR from a synthetic plasmid containing the sequence. The plasmid came from Lawrence Berkeley National Laboratory. This is a composite part containing the minimal promoter mCYC preceded by multiple consecutive binding sites for the Gli1 binding domain. This part contains the sequences for BBa_K165012 and BBa_K165016 but also has some additional DNA. false false _267_ 0 2510 58 It's complicated false It was necessary to design primers for use in PCR to remove this part from its host plasmid and transfer it to a standard Biobrick vector. false Aaron Glieberman BBa_K165032_sequence 1 ctcgagcgaagaccacccacaatgatggtcgaagaccacccacaatgatggtcgaagaccacccacaatgatggtcgaagaccacccacaatgatggtcgaagaccacccacaatgatggtcgaagaccacccacaatgatggtctcgagactagactcgagcagatccgccaggcgtgtatatatagcgtggatggccaggcaactttagtgctgacacatacaggcatatatatatgtgtgcgacgacacatgatcatatggcatgcatgtgctctgtatgtatataaaactcttgttttcttcttttctctaaatattctttccttatacattaggacctttgtagcataaattactatacttctatagacacacaaacacaaatacacacactaaattaataactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z