BBa_K1654001 1 BBa_K1654001 LuxR (vibrio harveyi) repressible promoter 2015-09-13T11:00:00Z 2015-09-14T01:08:02Z Genomic sequence of Vibrio Harveyi. This promoter activity is repressed in the presence of LuxR protein from vinrio harveyi. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_K1654001_sequence 1 tttttgagtcatttataaaatacaggttgatcttttatatatttctgtaccagaattgcgactgtcatttttaataaaaagataagtaaatagagtacgca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z