BBa_K1654004 1 BBa_K1654004 LuxO-P and sigma54 inducible promoter 2015-09-13T11:00:00Z 2015-09-14T01:04:54Z Genomic sequence of Vibrio Harveyi. Phosphorylated LuxO protein and sigma54 transcription factor induces the promoter activity. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_K1654004_sequence 1 aatgtattagtagcaatgcgcatggtggcatatttgcatcattttgcattttgcaaatgcgatttgcaaaatgcgtgctcaataaagcaccaatatgcatcaggatcgaagaaaaaaggcgtttttaaaagttggcacgcatcgtgctttatacagata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z