BBa_K1654000 1 BBa_K1654000 LuxR (vibrio harveyi) inducible promoter 2015-09-12T11:00:00Z 2015-09-13T09:17:25Z Genomic Sequence This promoter is being activated in the presence of LuxR protein. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_K1654005 1 BBa_K1654005 LuxR (vibrio harveyi) induced expression of Alyteserin-1a 2015-09-15T11:00:00Z 2015-09-16T04:08:22Z Synthesized using point method. This Biobrick is an expression system, which has usp45 secretion tag and releases Alyteserin-1a anitmicrobial peptide outside the Lactococcus lactis cell in the presence of LuxR protein (vibrio harveyi). false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh component2458976 1 BBa_B0012 component2458974 1 BBa_B0010 component2458972 1 BBa_K1654007 component2458971 1 BBa_K1654000 component2458973 1 BBa_K1654009 annotation2458972 1 BBa_K1654007 range2458972 1 327 407 annotation2458976 1 BBa_B0012 range2458976 1 584 624 annotation2458974 1 BBa_B0010 range2458974 1 496 575 annotation2458973 1 BBa_K1654009 range2458973 1 416 487 annotation2458971 1 BBa_K1654000 range2458971 1 1 320 BBa_K1654007 1 BBa_K1654007 USP45 secretion tag for Lactococcus lactis 2015-09-15T11:00:00Z 2015-09-16T03:53:03Z Sythesized USP45 secretion tag used in Lactococcus lactis to secrete the protein outside the cell. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1654009 1 BBa_K1654009 Alyteserin-1a coding 2015-09-15T11:00:00Z 2015-09-16T04:00:07Z Synthesized. Alyteserin-1a antimicrobial peptide. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1654009_sequence 1 ggtttaaaagatatttttaaagctggtttaggttcattagttaaaggtattgctgctcatgttgctaattaa BBa_K1654005_sequence 1 tctagtagtaacaactacttaaacatcattacttatttatagtgttacaaataacattaataatttatgcaatatttatgagtatgattccgctagtgtttaatagcgctgataaaatcaaaaactaaagtgtttgaagtttagttatttgttaagtgttacgactaattatagataagaagaactataattaaattaagtgataatagttctcgttactttgaactgtttaatgtatttggttaaaagtttttaattaactttaaaaaaatgatccaaggaattaatgttttccaaaatttaaaagagaagctcttgattactagatgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgctgccccgttgtcaggtgtttacgcttactagagggtttaaaagatatttttaaagctggtttaggttcattagttaaaggtattgctgctcatgttgctaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1654000_sequence 1 tctagtagtaacaactacttaaacatcattacttatttatagtgttacaaataacattaataatttatgcaatatttatgagtatgattccgctagtgtttaatagcgctgataaaatcaaaaactaaagtgtttgaagtttagttatttgttaagtgttacgactaattatagataagaagaactataattaaattaagtgataatagttctcgttactttgaactgtttaatgtatttggttaaaagtttttaattaactttaaaaaaatgatccaaggaattaatgttttccaaaatttaaaagagaagctcttgat BBa_K1654007_sequence 1 atgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgctgccccgttgtcaggtgtttacgct BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z