BBa_K1654000 1 BBa_K1654000 LuxR (vibrio harveyi) inducible promoter 2015-09-12T11:00:00Z 2015-09-13T09:17:25Z Genomic Sequence This promoter is being activated in the presence of LuxR protein. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_K1654011 1 BBa_K1654011 LuxR (vibrio harveyi ) repressible expression of Naly 2015-09-15T11:00:00Z 2015-09-16T04:20:49Z Synthesized This expression system releases a peptide outside L. lactis cells which neutralizes Alyteserin-1a antimicrobial peptide. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh component2459051 1 BBa_K1654000 component2459052 1 BBa_K1654007 component2459056 1 BBa_B0012 component2459054 1 BBa_B0010 component2459053 1 BBa_K1654001 annotation2459052 1 BBa_K1654007 range2459052 1 327 407 annotation2459054 1 BBa_B0010 range2459054 1 525 604 annotation2459056 1 BBa_B0012 range2459056 1 613 653 annotation2459051 1 BBa_K1654000 range2459051 1 1 320 annotation2459053 1 BBa_K1654001 range2459053 1 416 516 BBa_K1654007 1 BBa_K1654007 USP45 secretion tag for Lactococcus lactis 2015-09-15T11:00:00Z 2015-09-16T03:53:03Z Sythesized USP45 secretion tag used in Lactococcus lactis to secrete the protein outside the cell. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1654001 1 BBa_K1654001 LuxR (vibrio harveyi) repressible promoter 2015-09-13T11:00:00Z 2015-09-14T01:08:02Z Genomic sequence of Vibrio Harveyi. This promoter activity is repressed in the presence of LuxR protein from vinrio harveyi. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1654001_sequence 1 tttttgagtcatttataaaatacaggttgatcttttatatatttctgtaccagaattgcgactgtcatttttaataaaaagataagtaaatagagtacgca BBa_K1654000_sequence 1 tctagtagtaacaactacttaaacatcattacttatttatagtgttacaaataacattaataatttatgcaatatttatgagtatgattccgctagtgtttaatagcgctgataaaatcaaaaactaaagtgtttgaagtttagttatttgttaagtgttacgactaattatagataagaagaactataattaaattaagtgataatagttctcgttactttgaactgtttaatgtatttggttaaaagtttttaattaactttaaaaaaatgatccaaggaattaatgttttccaaaatttaaaagagaagctcttgat BBa_K1654007_sequence 1 atgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgctgccccgttgtcaggtgtttacgct BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1654011_sequence 1 tctagtagtaacaactacttaaacatcattacttatttatagtgttacaaataacattaataatttatgcaatatttatgagtatgattccgctagtgtttaatagcgctgataaaatcaaaaactaaagtgtttgaagtttagttatttgttaagtgttacgactaattatagataagaagaactataattaaattaagtgataatagttctcgttactttgaactgtttaatgtatttggttaaaagtttttaattaactttaaaaaaatgatccaaggaattaatgttttccaaaatttaaaagagaagctcttgattactagatgaaaaaaaagattatctcagctattttaatgtctacagtgatactttctgctgctgccccgttgtcaggtgtttacgcttactagagtttttgagtcatttataaaatacaggttgatcttttatatatttctgtaccagaattgcgactgtcatttttaataaaaagataagtaaatagagtacgcatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z