BBa_K1654002 1 BBa_K1654002 LuxR (vibrio harveyi) protein 2015-09-13T11:00:00Z 2015-09-14T12:52:24Z Genomic sequence of Vibrio Harveyi. This is key regulatory protein found in Vibrio Harveyi. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh BBa_K1654012 1 BBa_K1654012 LuxR expression system 2015-09-15T11:00:00Z 2015-09-16T04:30:56Z Genomic sequence of Vibrio Harveyi. This expression system produces LuxR protein which is involved in AI-2 signaling. false false _2072_ 24882 24882 9 false No. false Nitish Kumar Singh component2459092 1 BBa_B0010 component2459091 1 BBa_K1654002 component2459090 1 BBa_B0034 component2459094 1 BBa_B0012 component2459088 1 BBa_K1033225 annotation2459092 1 BBa_B0010 range2459092 1 712 791 annotation2459094 1 BBa_B0012 range2459094 1 800 840 annotation2459088 1 BBa_K1033225 range2459088 1 1 59 annotation2459091 1 BBa_K1654002 range2459091 1 86 703 annotation2459090 1 BBa_B0034 range2459090 1 68 79 BBa_K1033225 1 BBa_K1033225 Promoter CP44 2013-08-22T11:00:00Z 2015-05-08T01:08:49Z This part is a synthetic promoter based on a promoter library from the article "The Sequence of Spacers between the Consensus Sequences Modulates the Strength of Prokaryotic Promoters." by Peter Ruhdal Jensen and Karin Hammer. This part codes for a promoter that works in both E. coli and L. bacillus. It is characterized agains J23101, when J23101 had 4322 AU, this promoter had 17518 AU. false false _1340_ 0 17260 9 In stock false This part is designed with the same sticky ends as you would get by cutting it with EcoRI-HF and Spel. false Stephanie Herman, Alona Nyberg BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_K1654012_sequence 1 catcgggtagtttattcttgacaattaagtagagcctgatataatagttcagtactgtttactagagaaagaggagaaatactagatggactcaattgcaaagagacctcgtactaggctttcccctctaaaacgtaaacagcaactgatggaaatcgctcttgaagtgtttgctcgtcgcggcattggccgtggtggtcacgcggatattgcagagatcgctcaagtttctgttgcgacggtatttaactacttccctactcgtgaagatttggtggatgaagttctgaaccacgttgtgcgtcagttctctaacttcttgtcggataacatcgacttagacatccacgcgcgcgaaaacatcgccaacatcactaatgcaatgattgagctagtaagccaagattgccattggctgaaagtttggtttgagtggagcgcatcgacacgtgatgaagtatggccattattcgtgaccacaaaccgcactaaccaacttctagtgcaaaacatgttcatcaaagccatcgagcgtggtgaagtttgtgaccaacatgaaccggaacacttggcgaatctattccacggtatttgctactctattttcgtacaagcaaaccgctctaagagcgaagctgagttaacgaacctagtaagcgcatacttagatatgctatgcatctacaaccgtgaacatcactaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1033225_sequence 1 catcgggtagtttattcttgacaattaagtagagcctgatataatagttcagtactgtt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1654002_sequence 1 atggactcaattgcaaagagacctcgtactaggctttcccctctaaaacgtaaacagcaactgatggaaatcgctcttgaagtgtttgctcgtcgcggcattggccgtggtggtcacgcggatattgcagagatcgctcaagtttctgttgcgacggtatttaactacttccctactcgtgaagatttggtggatgaagttctgaaccacgttgtgcgtcagttctctaacttcttgtcggataacatcgacttagacatccacgcgcgcgaaaacatcgccaacatcactaatgcaatgattgagctagtaagccaagattgccattggctgaaagtttggtttgagtggagcgcatcgacacgtgatgaagtatggccattattcgtgaccacaaaccgcactaaccaacttctagtgcaaaacatgttcatcaaagccatcgagcgtggtgaagtttgtgaccaacatgaaccggaacacttggcgaatctattccacggtatttgctactctattttcgtacaagcaaaccgctctaagagcgaagctgagttaacgaacctagtaagcgcatacttagatatgctatgcatctacaaccgtgaacatcactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z