BBa_K1659001 1 Fla-Art175 Artilysin Art-175 fused at N-terminal with flagellin 26-47 peptide segment 2015-08-09T11:00:00Z 2016-02-01T12:51:52Z Art-175 amino acid sequence: Briers, Y., Walmagh, M., Grymonprez, B., Biebl, M., Pirnay, J. P., Defraine, V., ??? Lavigne, R. (2014). Art-175 is a highly efficient antibacterial against multidrug-resistant strains and persisters of Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy, 58(7), 3774???3784. http://doi.org/10.1128/AAC.02668-14 Amino acid sequence of Fla 26-47: Balb??s, P., & Lorence, A. (2004). Recombinant Gene Expression. Reviews and Protocols, 267, 506. http://doi.org/10.1007/978-1-61779-433-9 Artilysins are an exciting class of enzyme-based antibacterials. Their name is derived from "artificial endolysin" and they exploit the lytic power of bacteriophage-encoded endolyins. Endolysins are peptidoglycan hydrolases produced at the end of the lytic cycle that pass through the cytoplasmic membrane, degrade the peptidoglycan layer and cause the osmotic lysis of the infected bacterial cell, thus liberating the progeny. Purified endolysins have been used to kill Gram-positive pathogens. Gram-negative bacteria, however, have a protective outer membrane containing lipopolysaccharide (LPS) that serves as a barrier against the peptidoglycan hydolytic activity of endolysins from the outside. To overcome this problem, selected polycationic or amphipathic peptides that locally destabilize the LPS layer have been covalently fused to endolysins. Biers et al. fused the sheep myeloid antimicrobial peptide (SMAP-29) to the N terminus of the endolysin KZ144 to create Artilysin 175. Art-175 has been shown to be a highly potent antibacterial that acts in minutes to kill virtually all Pseudomonas aeruginosa strains. [1] BBa_K1659001 is a composite of Art-175 with the 26-47 segment of Salmonella typhimurium flagellin combined with a hexahistidine tag. [2] Fla 26-47 is capable of mediating flagellar export of recombinant proteins and, combined with a hexahistidine tag, facilitates their secreted expression and easy purification. [1] Briers, Y., Walmagh, M., Grymonprez, B., Biebl, M., Pirnay, J. P., Defraine, V., ??? Lavigne, R. (2014). Art-175 is a highly efficient antibacterial against multidrug-resistant strains and persisters of Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy, 58(7), 3774???3784. http://doi.org/10.1128/AAC.02668-14 [2] Balb??s, P., & Lorence, A. (2004). Recombinant Gene Expression. Reviews and Protocols, 267, 506. http://doi.org/10.1007/978-1-61779-433-9 false false _2077_ 4206 24525 9 false Export signal combined with hexahistidine tag false Raphaella Hull annotation2438074 1 stop range2438074 1 1054 1056 annotation2438072 1 stop range2438072 1 1051 1053 annotation2438068 1 Art-175 range2438068 1 166 1032 annotation2438066 1 start range2438066 1 1 3 annotation2438058 1 Flagellin 26-47 Secretion Signal Tag range2438058 1 4 165 annotation2438070 1 Hisx6 range2438070 1 1033 1050 BBa_K1659001_sequence 1 atgaccatgatcactccctcgttgcaccaccaccaccatcatgggaccgcgatcgagcgtctgagtagcggactgcgtatcaatagcgcgaaagatgatgccgctggcgatgacgacgataaagcttccggttctttacaggctgcggcgagcagtctggaagtacgcggcctgcgccgtttgggacgcaaaattgcacatggggtcaaaaaatatggcccaaccgtgctgcgcatcattcgcattgcgggcatgaaagttctgcgcaaaggtgatcgtggtgacgaagttagccaattgcaaacgctcctgaatctgtcaggatatgatgtaggcaagccggacggtattttcggcaataatacctttaaccaggttgtgaaattccagaaagataactccttggacagcgatggcatcgttgggaaaaatacgtgggcggaactgttttcaaaatattcccctccaattccgtacaaaactattcctatgcccaccgctaacaagtcacgtgcggcggctacaccggttatgaatgcagtggagaacgccaccggcgtacgctctcagctgctgctgaccttcgcctccattgaatccgcttttgattacgaaattaaagctaaaacctctagcgcgacgggctggttccagttcctcactggtacatggaaaactatgatcgaaaactatggtatgaaatacggtgtccttacagatcccaccggtgcgttgcgcaaagatccgcgcatcagcgccctgatgggagcggaattgattaaagagaacatgaatatcctgcgtcccgtactgaaacgtgaaccgaccgacaccgacctgtatttagcccacttttttggaccgggtgctgctcgccgcttcctgaccaccggccaaaatgagttggccgcaacacattttcctaaagaagcacaagccaatccaagcattttctataataaagacggcagccctaaaacgatccaagaagtctataatctgatggatggcaaagttgccgcgcatcgtaaacatcaccaccatcatcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z