BBa_K1659002 1 Dsb-Art175 Artilysin Art-175 fused at N-terminal with DsbA signal peptide 2015-08-25T11:00:00Z 2016-02-01T12:52:09Z Endolysin KZ144 originates from Pseudomonas aeruginosa bacteriophage varphiKZ. SMAP-29 originates from sheep genomic DNA. Artilysins are an exciting class of enzyme-based antibacterials. Their name is derived from "artificial endolysin" and they exploit the lytic power of bacteriophage-encoded endolysins. Endolysins are peptidoglycan hydrolases produced at the end of the lytic cycle that pass through the cytoplasmic membrane, degrade the peptidoglycan layer and cause the osmotic lysis of the infected bacterial cell, thus liberating the progeny. Purified endolysins have been used to kill Gram-positive pathogens. Gram-negative bacteria, however, have a protective outer membrane containing lipopolysaccharide (LPS) that serves as a barrier against the peptidoglycan hydrolytic activity of endolysins from the outside. To overcome this problem, selected polycationic or amphipathic peptides that locally destabilize the LPS layer have been covalently fused to endolysins. Biers et al. fused the sheep myeloid antimicrobial peptide (SMAP-29) to the N terminus of the endolysin KZ144 to create Artilysin Art-175. Art-175 has been shown to be a highly potent antibacterial that acts in minutes to kill virtually all Pseudomonas aeruginosa strains. [2] BBa_K1659002 is a composite of Art-175 with the N-terminal DsbA signal peptide with a hexahistidine tag. DsbA targets recombinant proteins to the co-translational signal- recognition-particle (SRP)-dependent pathway to mediate secretion out of the bacterial chassis. [2] false false _2077_ 4206 24524 9 false - false Wei Chung Kong annotation2445687 1 Art-175 range2445687 1 58 924 annotation2445689 1 stop range2445689 1 943 948 annotation2445685 1 start range2445685 1 1 3 annotation2445688 1 Hisx6 range2445688 1 925 942 annotation2445686 1 DsbA 2-19 Signal Sequence range2445686 1 4 57 BBa_K1659002_sequence 1 atgaaaaagatttggctggcgctggctggtttagttttagcgtttagcgcatcggcgcgcggcctgcgccgtttgggacgcaaaattgcacatggggtcaaaaaatatggcccaaccgtgctgcgcatcattcgcattgcgggcatgaaagttctgcgcaaaggtgatcgtggtgacgaagttagccaattgcaaacgctcctgaatctgtcaggatatgatgtaggcaagccggacggtattttcggcaataatacctttaaccaggttgtgaaattccagaaagataactccttggacagcgatggcatcgttgggaaaaatacgtgggcggaactgttttcaaaatattcccctccaattccgtacaaaactattcctatgcccaccgctaacaagtcacgtgcggcggctacaccggttatgaatgcagtggagaacgccaccggcgtacgctctcagctgctgctgaccttcgcctccattgaatccgcttttgattacgaaattaaagctaaaacctctagcgcgacgggctggttccagttcctcactggtacatggaaaactatgatcgaaaactatggtatgaaatacggtgtccttacagatcccaccggtgcgttgcgcaaagatccgcgcatcagcgccctgatgggagcggaattgattaaagagaacatgaatatcctgcgtcccgtactgaaacgtgaaccgaccgacaccgacctgtatttagcccacttttttggaccgggtgctgctcgccgcttcctgaccaccggccaaaatgagttggccgcaacacattttcctaaagaagcacaagccaatccaagcattttctataataaagacggcagccctaaaacgatccaagaagtctataatctgatggatggcaaagttgccgcgcatcgtaaacatcaccaccatcatcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z