BBa_K1659100 1 MccS Microcin S, a Class II microcin produced by probiotic E. coli G3/10 2015-08-09T11:00:00Z 2016-02-03T10:51:08Z UniProtKB - H9ZMG7 (H9ZMG7_ECOLX) Microcins are antibacterial peptides. Microcin S was isolated from Escherichia coli G3/10, a component of the probiotic drug Symbioflor 2. Here it was shown to be responsible for E. coli G3/10's ability to suppress adherence of enteropathogenic E. coli E2348/69. [1] The Microcin S operon is about 4.7 kb in size and is comprised of four genes. This part is the sequencing encoding the microcin itself (mcsS). [1] Zsch??ttig, A., Zimmermann, K., Blom, J., Goesmann, A., P??hlmann, C., & Gunzer, F. (2012). Identification and characterization of microcin S, a new antibacterial peptide produced by probiotic Escherichia coli G3/10. PLoS ONE, 7(3), 1???9. http://doi.org/10.1371/journal.pone.0033351 false false _2077_ 4206 24525 9 false No specific design considerations false Raphaella Hull annotation2449244 1 Microcin S range2449244 1 4 360 annotation2449246 1 stop range2449246 1 379 384 annotation2449245 1 Hisx6 range2449245 1 361 378 annotation2449243 1 start range2449243 1 1 3 BBa_K1659100_sequence 1 atgagtaatattcgcgaactgtctttcgacgaaattgccctggtttcagggggcaacgccaactctaattatgaaggcggcggcagccgtagccgtaataccggggcacgcaattccctgggccgcaatgcgccaacccacatttattctgatccgagcactgtcaaatgcgcgaacgcagtgtttagtgggatggtcggtggggcaattaaaggaggccctgtaggtatgacgcgtggtaccatcggcggcgctgtgattggtcagtgccttagcgggggcggtaacggcaatggagggggtaatcgcgccggttcgagtaattgcagcggttcaaacgttggcggtacgtgtagccgtcatcaccaccatcatcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z