BBa_K1660009 1 BBa_K1660009 J23100-B0034-rMpL 2015-09-07T11:00:00Z 2015-09-08T01:13:59Z It comes from Macrolepiota procera cDNA. encodes a nematotoxic lectin from the parasol mushroom(Macrolepiota procera) under the control of a constitutive promoter. false false _2078_ 26933 26933 9 false We optimized the codon sequence for E. coli. and add a constitutive promoter J23100 upstream the coding sequence of rMpL, so that this parts can express rMpL lectin continuously. false Dai Yuanyi annotation2446548 1 B0034 range2446548 1 44 55 annotation2446551 1 stop codon range2446551 1 485 487 annotation2446549 1 rMpL range2446549 1 62 487 annotation2446547 1 J23100 range2446547 1 1 35 annotation2446550 1 start codon range2446550 1 62 64 BBa_K1660009_sequence 1 ttgacggctagctcagtcctaggtacagtgctagctactagagaaagaggagaaactcgagatgagcacccaggtgagcagcggccagacctacaaaatcaccaacgtgaaagccggcaccgtgatcgacctgagcggcgaagataacaaaagcattattggctacccgtatcacagcggcaagaatcagcagtggaccttcaactggaccggtaaagcctggacactgcgcagcgcaagcagcggtagctatctgggtatcgaaggtaccccggcagatggcacccgtctggttgccgtgaacgacccgtttgaatggcacatttggcgcgatgaggccaatgagaacgccttccgcatctttgtgccgtttaccaactataacctggatctgagcggctacggcgataccaccccgggtacaccggtgcagctgtggtggacatgggaaggtctgcaccagacctggaccattgatcgcccgtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z