BBa_K1667001 1 BBa_K1667001 strong promoter-RNA thermometer 2015-09-06T11:00:00Z 2015-09-07T06:30:26Z The sequence of the strong promoter in this part is from BB_J23106 in igem. The sequence of the RNA thermometer in this part is from BB_K115017 in igem. A strong promoter followed with a RNA thermometer sequence, which regulate the transcription of downstream gene in a temperature-dependent manner. When the temperature is above 32 degree centigrade, the gene transcription will go on, otherwise the gene transcription will be blocked. false false _2085_ 27665 27665 9 false This strong promoter is commonly used in gene engineering, and the RNA thermometer of 32 degree centigrade is very easy to control. false Jinyan Chu BBa_K1667001_sequence 1 tttacggctagctcagtcctaggtatagtgctagcccgggcgcccttcgggggcccggcggagacgggcgccggaggtgtccgacgcctgctcgtccagtctttgctcagtggaggattactag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z