BBa_K1667003 1 BBa_K1667003 RecA promoter 2015-09-06T11:00:00Z 2015-09-07T08:36:43Z There is a DNA spacer fragment in front of the promoter sequence. A UV induced promoter. When the host cell is exposed in UV, the promoter will be actived, and the transcription of downstram gene will be started. false false _2085_ 27665 27665 9 false The sequence of the RecA promoter in this part is from BB_J22106 in igem. false Jinyan Chu BBa_K1667003_sequence 1 cgaacagaaagtaatcgtattgtacacggccgcataatcgaactagaaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z