BBa_K1667004 1 BBa_K1667004 suicide gene ccdB 2015-09-06T11:00:00Z 2015-09-07T06:58:03Z The sequence of the ccdB gene in this part is from BB_K145151 and BB_K1010007 in igem. The gene of ccdB is a lethal gene. The expression of ccdB gene will lead to the death of the host cells. false false _2085_ 27665 27665 9 false There is a rbs sequence in front of the ccdB gene fragment to ensure the translation of it. false Jinyan Chu BBa_K1667004_sequence 1 taattttgtttaactttaagaaggagatataccaagcttatgcagtttaaggtttacacctataaaagagagagccgttatcgtctgtttgtggatgtacagagtgatattattgacacgcccgggcgacggatggtgatccccctggccagtgcacgtctgctgtcagataaagtctcccgtgaactttacccggtggtgcatatcggggatgaaagctggcgcatgatgaccaccgatatggccagtgtgccggtctccgttatcggggaagaagtggctgatctcagccaccgcgaaaatgacatcaaaaacgccattaacctgatgttctggggaatataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z