BBa_K1667009 1 BBa_K1667009 RecA promoter 2015-09-06T11:00:00Z 2015-09-07T08:31:55Z The sequence of the RecA promoter in this part is from BB_J22106 in igem. A UV induced promoter. When the host cell is exposed in UV, the promoter will be actived, and the transcription of downstram gene will be started. true false _2085_ 27665 27665 9 Not in stock false There is a DNA spacer seqence in front of the promoter. false Jinyan Chu BBa_K1667009_sequence 1 cgaacagaaagtaatcgtattgtacacggccgcataatcgaactagtaacaatttctacaaaacacttgatactgtatgagcatacagtataattgcttcaacagaacatattgactatccggtattacccggcatgacaggagtaaaaatggctatcgacgaaaacaaacagaaagcgttggcggcagcactgggccagattgagaaacaatttggtaaaggctccatcatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z