BBa_K1668002 1 frr frr (from Streptomyces avermitilis, increasing avermectin production) 2015-09-07T11:00:00Z 2015-09-11T06:20:46Z The metK gene was amplified by PCR with genomic DNA of S. avermitilis(具体型号) as template using primers Frr gene encodes the ribosome recycling factor (RRF), which is involved in the release of ribosomes from the translational post-termination complex for a new round of initiation. In comparison to the wild-type strain, avermectin yield was increased significantly by 3- to 3.7-fold in transformants 31267(pFRR-1139) and 31267(pFRRerm-1139), both of which contained multiple frr copies, compared with that in the control strains. The avermectin productivity of each culture was quantitatively measured by HPLC analysis. Research indicated that frr overexpression promoted cell growth as well as the expression of ave genes (including pathway-specific positive regulatory gene aveR for avermectin biosynthesis and ave structural genes), leading in turn to avermectin overproduction. Different from S-adenosylmethionine synthetase gene (metK), frr gene revealed a ??????copy number effect??????: multiple copies of frr had a greater promoting effect on avermectin production than a single copy in each of the three transformed S. avermitilis strains. false false _2086_ 24510 24510 9 false We used seamless assembly. false Xintian Xu annotation2449088 1 stop coden range2449088 1 379 384 annotation2456727 1 cds range2456727 1 1 384 annotation2449087 1 start coden range2449087 1 1 3 BBa_K1668002_sequence 1 atgcgcgggtacgtcgggcacgatgggcatggggcgagtctgctgcgcgtcatgcgcatcgtacgtgggacccgccggggctgccccctgggcaggcccctggtcggacggcccccagtacccggcttgtggcggcgccccccaggaagattcgttcatcagacctcgagcagctccgcttccttgtgcttgagcagctcgtccacctgggcgacgtacttcgcggtggtgtcgtcgagctccttctccgcacgacggccctcgtcctcgccgacctcgccatccttgatcagcttgtcgatggcgtccttggccttgcggcggacggagcggatcgagaccttggcgtcctcacccttggtcttggcgaccttgatgtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z