BBa_K1668004 1 BBa_K1668004 ermEp (a strong constitutive promoter in S. avermitilis) 2015-09-07T11:00:00Z 2015-09-15T05:56:46Z The metK gene was amplified by PCR with genomic DNA of S. avermitilis(具体型号) as template using primers metK1 and metK2（ metK is the S-adenosylmethionine synthetase gene from Streptomyces avermitilis, which was found to stimulate the production of avermectins. When wild-type strain ATCC31267 was transformed with pYJ02 and pYJ03, two metK expression plasmids, avermectin production was increased about 2.0-fold and 5.5-fold compared with that in the control strains, respectively. The avermectin productivity of each culture was quantitatively measured by HPLC analysis. As the kinetic study revealed, avermectin overproduction in recombinant strain was not caused by the change of cell growth rate or copy number effect. Instead, metK stimulates the avermectin production by increasing the intracellular concentration of S-adenosylmethionine (SAM), an important intermediate product in avermectin production. However, there may be a maximum concentration of SAM for the production of avermectin in S. avermitilis, over which it has no any effect on the antibiotic production. The results of experiments showed that there were different effects of metK expression levels on avermectin production in various S. avermitilis strains. The gene expression levels of metK in two engineered strain, GB-165 and 76-05, were much higher then those in wild-type strain, whereas the avermectin productivity in these two strains were not significantly improved. It probably because the high expression level of metK limited the increasement of avermectin by overexpression of metK. false false _2086_ 24510 24510 9 false We use seamless assembly. false Xintian Xu annotation2456753 1 promoter range2456753 1 1 155 BBa_K1668004_sequence 1 ggcggcttgcgcccgatgctagtcgcggttgatcggcgatcgcaggtgcacgcggtcgatcttgacggctggcgagaggtgcggggaggatctgaccgacgcggtccacacgtggcaccgcgatgctgttgtgggcacaatcgtgccggttggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z