BBa_K1670005 1 BBa_K1670005 EsaR repressor/activator 2015-08-25T11:00:00Z 2015-08-26T03:10:38Z Synthesized gBlock according to the sequence information from gene sequencing from Erwinia stewartii GenBank: L32183.1 and [3] <a href=??? http://parts.igem.org/partsdb/edit_seq.cgi?part=BBa_K1670001???> BBa_K1670001</a>encodes for the regulatory protein EsaR of the EsaR/I quorum sensing system from <i> Erwinia stewartii </i>. Contrary to most other quorum sensing systems, EsaR works as a repressor rather than an activator. It binds at its corresponding binding box between the -10 and the -35 region of its corresponding promoter and inhibits transcription. Binding of 3OC6-HSL to EsaR induced an allosteric change in the structure that prevents its DNA-binding ability and thus induces expression. If the binding box is positioned shortly upstream of the promotor, EsaR also works as an activator of the respective promoter as long as it can bind to the DNA. We use a D91G variant of the gene that shows higher sensitivity towards 3OC6-HSL [2]. false false _2088_ 24905 24905 9 false We use a D91G variant of the gene that shows higher sensitivity towards 3OC6-HSL [2] false Christoph Schilling annotation2438027 1 RBS range2438027 1 1 32 annotation2438029 1 STOP range2438029 1 780 788 annotation2438028 1 esaR range2438028 1 33 779 BBa_K1670005_sequence 1 gctagctcaaataccacataaggaggtctcaaatgttttcttttttccttgaaaatcaaacaataacggatacgcttcagacttacatacagagaaagttatctccgctgggtagtccggattacgcttacactgttgtgagcaaaaaaaatccttcaaatgttctgattatttccagttatcctgacgaatggattaggttataccgcgctaacaactttcagctgaccgatccggttattctcacggcctttaaacgcacctcgccgtttgcctgggatgagaatattacgctgatgtccggcctgcggttcaccaaaattttctctttatccaagcaatacaacatcgttaacggctttacctatgtcctgcatgaccacatgaacaaccttgctctgttgtccgtgatcattaaaggcaacgatcagactgcgctggagcaacgccttgctgccgaacagggcacgatgcagatgctgctgattgattttaacgagcagatgtaccgcctggccggtaccgaaggcgagcgagccccggcgttaaatcagagcgcggacaaaacgatattttcctcgcgtgaaaatgaggtgttgtactgggcgagtatgggcaaaacctatgctgagattgccgctattacgggcatttctgtgagtaccgtgaagtttcacatcaagaatgtggtcgtgaaactgggcgtcagtaacgcccgacaggctatcagactgggtgtagaactggatcttatcagaccggcagcgtcagcggccaggtagtaataaggatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z