BBa_K1673204 1 BBa_K1673204 T7 Endonuclase (Mutation Optimized) 2015-09-16T11:00:00Z 2015-09-17T09:51:30Z Synthesized DNA Repair enzyme that induces double strand breaks at DNA base mismatches false false _2091_ 19415 19415 9 false Sequence produced by the Vanderbilt iGEM 2015 mutation optimization software. false Jarrod Shilts BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508159 1 BBa_B0034 range1508159 1 209 220 annotation1508149 1 BBa_R0010 range1508149 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1673214 1 BBa_K1673214 Mutation Optimized T7 Endonuclease with IPTG Promoter 2015-09-16T11:00:00Z 2015-09-17T10:06:35Z Synthesized DNA K1673204 T7 Endonuclease under R0010 IPTG-inducible promoter false false _2091_ 19415 19415 9 false BioBrick Assembly false Jarrod Shilts component2468763 1 BBa_J04500 component2468764 1 BBa_K1673204 annotation2468764 1 BBa_K1673204 range2468764 1 227 676 annotation2468763 1 BBa_J04500 range2468763 1 1 220 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961227 1 start range1961227 1 173 173 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K1673204_sequence 1 atggctggttatggtgctaaaggtataagaaaagttggtgcttttagaagtggtcttgaagataaagttagtaaacaacttgaaagtaaaggtataaaatttgaatatgaagaatggaaagttccttatgttatacctgctagtaatcatacttatactcctgattttcttcttcctaatggtatatttgttgaaactaaaggtctttgggaaagtgatgatagaaaaaaacatcttcttataagagaacaacatcctgaacttgatataagaatagtttttagtagtagtagaactaaactttataaaggtagtcctactagctatggtgaattttgtgaaaaacatggtataaaatttgctgataaacttatacctgctgaatggataaaagaacctaaaaaagaagttccttttgatagacttaaaagaaaaggtggtaaaaaatga BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K1673214_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggctggttatggtgctaaaggtataagaaaagttggtgcttttagaagtggtcttgaagataaagttagtaaacaacttgaaagtaaaggtataaaatttgaatatgaagaatggaaagttccttatgttatacctgctagtaatcatacttatactcctgattttcttcttcctaatggtatatttgttgaaactaaaggtctttgggaaagtgatgatagaaaaaaacatcttcttataagagaacaacatcctgaacttgatataagaatagtttttagtagtagtagaactaaactttataaaggtagtcctactagctatggtgaattttgtgaaaaacatggtataaaatttgctgataaacttatacctgctgaatggataaaagaacctaaaaaagaagttccttttgatagacttaaaagaaaaggtggtaaaaaatga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z