BBa_K1673301 1 BBa_K1673301 Bidirectional IPTG Promoter 2015-09-16T11:00:00Z 2015-09-17T10:13:17Z Synthesized DNA. Based off of promoter designed in Yang et al 2012 IPTG-Inducible promoter based on R0010 that can initiate transcription in both directions. Based off of promoter designed in Yang et al 2012 false false _2091_ 19415 19415 9 false None false Jarrod Shilts BBa_K1673301_sequence 1 aattgtgagccgataacatttgacattgtgagcggataactgtcaaatgagcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z