BBa_K1673304 1 BBa_K1673304 umuDC UV-Inducible Promoter 2015-09-16T11:00:00Z 2015-09-17T10:23:43Z Synthesized DNA. From Li et al 2007 E. coli promoter that is induced by ultraviolet irradiation false false _2091_ 19415 19415 9 false None false Jarrod Shilts BBa_K1673304_sequence 1 gcttattgacatgctggcaagaacagactactgtatataaaaacagtatactcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z