BBa_K1675026 1 BBa_K1675026 P-atp2-B0034-lacz alpha 2015-09-14T11:00:00Z 2015-09-16T09:38:13Z Error prone PCR of P-atp2, then overlap extension of synthetic oligonucleotides. The natural P-atp2 is from Corynebacterium glutamicum. Lacz alpha is from http://parts.igem.org/wiki/index.php?title=Part:BBa_I732006 The natural P-atp2 is an alkali-induced promoter in Corynebacterium glutamicum located in F0F1 ATPase operon. The natural P-atp2 promoter responds to the pH changes from pH 7.0 to pH 9.0, especially at alkaline pH. When the pH value increasing, the expression increased modestly. It is activated by the alternative sigma factor of the RNA polymerase, whose synthesis would be activated when the bacteria are growing at alkaline pH. The activity of this mutant at different pH is shown in figure 1. true false _2093_ 28109 28109 9 Not in stock false There is an EcoRI site exists in the P-atp2 sequence, so we mutate it to change it. false Jing Yang BBa_K1675026_sequence 1 agtgtccgtgctgggaaactggcggggaacttttagagataaccctccgaattgctggcaaatttctgatgaaatttctccgcgaagcccacatgaactacccccgtttaccctcaaaataagccctgtgacacacataacaccccctaatcgtacccgctcacacgctattttcgaggtgtggttcgccttcggaaacgaatgcccccgccccacttggataaaagacgttaacacctgttagtctataacgcgggttgaaccgagaaacccctcaaggcagcagacaatagccgcaaggggttttgcggagcacgtcccctgtgatcgttgcgctgatgtgcgacggagtccgaaagaggagaaatactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z