BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 annotation1961227 1 start range1961227 1 173 173 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961223 1 CAP binding site range1961223 1 89 126 BBa_K314201 1 Tsi2 Antitoxin Tsi2 2010-10-17T11:00:00Z 2015-05-08T01:11:55Z pseudomonas aeruginosa Released HQ 2013 Protein originating from pseudomonas aeruginosa that confers immunity to the toxic protein Tse2 false false _496_ 0 6395 9 In stock true false Matthew Coyne, Ingrid Swanson, Jesa Landis, Matthew Harger annotation2089457 1 tsi2 range2089457 1 1 234 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1677000 1 BBa_K1677000 IPTG Inducible Tsi2 Antitoxin 2015-07-14T11:00:00Z 2015-07-15T07:28:19Z The source of these parts was the 2015 Distribution Kit. For further information look at the components of the part This is an IPTG Inducible promoter (with RBS) that produces the Tsi2 Antitoxin. This part, when expressed on a different plasmid to Tse2 (under a constitutive promoter), can prevent horizontal gene transfer of the Tse2 plasmid and can will also prevent escape of the GMO bacteria from outside of the lab (where IPTG isn't present) false false _2095_ 24918 24918 9 false - false Isabelle Capell-Hattam component2433108 1 BBa_J04500 component2433110 1 BBa_K314201 annotation2433108 1 BBa_J04500 range2433108 1 1 220 annotation2433110 1 BBa_K314201 range2433110 1 227 460 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508159 1 BBa_B0034 component1508149 1 BBa_R0010 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K314201_sequence 1 atgaacctgaaaccccagaccctgatggtggcgatccagtgcgtcgccgcgcgcacccgcgaactcgacgcgcagttgcagaacgacgacccgcagaacgccgctgaactcgaacagttgctggtcggctacgacctcgccgccgacgacctgaagaacgcctacgagcaagccctgggccaatacagcggcctgccgccctatgaccggctgatcgaagagccggcatcctga BBa_K1677000_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatgaacctgaaaccccagaccctgatggtggcgatccagtgcgtcgccgcgcgcacccgcgaactcgacgcgcagttgcagaacgacgacccgcagaacgccgctgaactcgaacagttgctggtcggctacgacctcgccgccgacgacctgaagaacgcctacgagcaagccctgggccaatacagcggcctgccgccctatgaccggctgatcgaagagccggcatcctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z