BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961227 1 start range1961227 1 173 173 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_K1677743 1 BBa_K1677743 TGV Pseudoknot 2015-08-24T11:00:00Z 2015-08-25T02:16:32Z Transmissible gastroenteritis virus This is part of the BABS iGEM pseudoknot suite. This pseudoknot can be used for delayed translation of a protein sequence, by slowing the ribosome. false false _2095_ 24918 24918 9 false All start codons had to be removed from the pseudoknot. 20 base pairs from the viral DNA flank either side of the pseudoknot region. <br> 3' flanking sequence ATCAAAGTTATTTAAACGAG <br> 5' flanking sequence TTTGACATCTACAACAAAGA <br> The actual pseudoknot is: <br> UGCGGGGUUCUAGUGCAGCUCGACUAGAACCCUGCAUUGGUACUGAUCCAGACCAAGUUAGUAGAGCU <br> ((((((((((((((..[[[[[.))))))))))))))(((((.(((...)))))))).......]]]]] <br> Estimated free energy: -33.47 kcal/mol false Isabelle Capell-Hattam annotation2466139 1 5' Flanking Region range2466139 1 88 108 annotation2466140 1 TGV Pseudoknot range2466140 1 20 88 annotation2466138 1 3' Flanking Region range2466138 1 1 20 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J04500 1 BBa_J04500 IPTG inducible promoter with RBS 2005-06-08T11:00:00Z 2015-08-31T04:08:14Z Davidson Synth-Aces Released HQ 2013 R0010.B0034 false true _16_ 0 326 16 In stock false false Kristen DeCelle component1508149 1 BBa_R0010 component1508159 1 BBa_B0034 annotation1508149 1 BBa_R0010 range1508149 1 1 200 annotation1508159 1 BBa_B0034 range1508159 1 209 220 BBa_K1677801 1 BBa_K1677801 IPTG inducible promoter with TGV pseudoknot 2015-09-16T11:00:00Z 2015-09-17T04:15:10Z Registry. See individual parts for more details. An IPTG inducible promoter with TGV pseudoknot. false false _2095_ 25020 25020 9 false -- false Manan Shah component2465641 1 BBa_K1677743 component2465640 1 BBa_J04500 annotation2465640 1 BBa_J04500 range2465640 1 1 220 annotation2465641 1 BBa_K1677743 range2465641 1 229 336 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_J04500_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaa BBa_K1677801_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagagatcaaagttatttaaacgagtgcggggttctagtgcagctcgactagaaccctgcattggtactgatccagaccaagttagtagagcttttgacatctacaacaaaga BBa_K1677743_sequence 1 atcaaagttatttaaacgagtgcggggttctagtgcagctcgactagaaccctgcattggtactgatccagaccaagttagtagagcttttgacatctacaacaaaga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z