BBa_K1678002 1 BBa_K1678002 RibT promoted by p25 synthetic promoter 2015-09-15T11:00:00Z 2015-09-18T06:54:59Z CDS sequence is coming from the genomic sequence of Bacillus subtilis. Bacillus subtilis RibT gene for riboflavin production. RibT codes for the Beta-chain of the Riboflavin synthase. Coding sequence has been codon optimized for Lactobacillus plantarum. Protein is expressed by L.plantarum synthetic promoter p25 (Design description in 'A synthetic promoter library for constitutive gene expression in Lactobacillus plantarum', Microbiology (2006), 152, 1011???1019.). The gene is terminated by the Tldh terminator (Spath et al. Microbial Cell Factories 2012, 11:141). The RBS and the spacing between the RBS and the coding sequence are optimized for Lactobacillus plantarum (Tauer et al. Microbial Cell Factories 2014, 13:150). The expressed protein catalyses one step in the riboflavin pathway. ArPP+ DHBP -> DRL false false _2096_ 27599 25228 9 false none false Barthelemy Caron annotation2474752 1 RBS range2474752 1 82 88 annotation2462457 1 Tldh Termintator range2462457 1 472 609 annotation2462456 1 RibT range2462456 1 97 471 annotation2462455 1 p25 promoter range2462455 1 22 81 BBa_K1678002_sequence 1 ccgcgtatagaagactgctagagatctgtggggttagttgttgacattaaggcacatcattgatatggtttaattatagcgaaggaggaaatttacatgttaatccgttacaagaagtcattcgaaaagatcgctatgggtttattatcattcatgccaaacgaaaaggatttaaagcaattacaacaaactatcaaggattacgaaactgatactgatcgtcaattattcttatggaaggaagatgaagatatcgttggtgctatcggtgttgaaaagaaggattcagaagttgaaatccgtcacatctcagttaacccatcacaccgtcaccaaggtatcggtaagcaaatgatggatgctttaaagcacttattcaagactcaagttttagttccaaacgaattaactcaatcattcttcgaacgttgtcaaggtcaacaagatcaagatatctcatacaacaactaagctcgtcaggttaagcgctcagcttaacggtgtctctccagacgagtatcactaagccaccgtaccaaaaaaccgctgtccgagaccgcgcgtcacaacgcgggcaatctcaggcagcggcttttttaatctttttctggggttgtcttcatatgctgctg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z