BBa_K1679004 1 BBa_K1679004 J23101 and RiboJ 2015-09-15T11:00:00Z 2015-09-18T06:26:36Z BBa_J23101 We synthesized RiboJ. Our reference is Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142. BBa_J23101 is a strong promoter which is well characterized by many teams who take part in 2015 InterLab Study. RiboJ is a Ribozyme-based insulator part that can buffer synthetic circuits from genetic context. This part can be used as a promoter-like parts. false false _2097_ 25072 21726 9 false We want to make a promoter part containing RiboJ to buffer synthetic circuits from genetic context. We synthesized RiboJ with EXSP site and use 3A Assembly to construct this part. false Qikai Qin component2474697 1 BBa_K1679038 component2474696 1 BBa_J23101 annotation2474697 1 BBa_K1679038 range2474697 1 44 118 annotation2474696 1 BBa_J23101 range2474696 1 1 35 BBa_J23101 1 BBa_J23101 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z later Released HQ 2013 later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1679038 1 BBa_K1679038 RiboJ 2015-09-17T11:00:00Z 2015-09-18T01:15:04Z Synthesized by Genewiz. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin immediately downstream to help expose the RBS. STRSV can cleaves the mRNA autocatalytically at a defined residue, which had the effect of cleaving extraneous RNA leaders that arose from transcription from promoters with different start sites.[1] Attributed to the biochemical function mentioned above, RiboJ has insulating capability. We use it to buffer synthetic circuits from genetic context. [1] Lou C, Stanton B, Chen Y J, et al. Ribozyme-based insulator parts buffer synthetic circuits from genetic context[J]. Nature biotechnology, 2012, 30(11): 1137-1142. false false _2097_ 25072 25072 9 false After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme and an additional 23-nt hairpin. Users can insert it into promoter and RBS to reduce noise caused by upstream sequence and stabilize mRNA. false Xihan Zhang BBa_K1679004_sequence 1 tttacagctagctcagtcctaggtattatgctagctactagagttaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagct BBa_J23101_sequence 1 tttacagctagctcagtcctaggtattatgctagc BBa_K1679038_sequence 1 ttaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z