BBa_E1010 1 mRFP1 **highly** engineered mutant of red fluorescent protein from Discosoma striata (coral) 2004-07-27T11:00:00Z 2015-08-31T04:07:26Z Campbell et al., PNAS v99 p7877 <a href="http://www.pubmedcentral.nih.gov/articlerender.fcgi?tool=pubmed&pubmedid=12060735">URL</a> Released HQ 2013 monomeric RFP: Red Fluorescent Protein. Excitation peak: 584 nm Emission peak: 607 nm false false _11_1_ 0 52 7 In stock false TAATAA double stop codon added (DE). Four silent mutations made to remove three EcoRI sites and one PstI site: A28G, A76G, A349G, G337A. true Drew Endy annotation1014044 1 mrfp1 range1014044 1 1 675 annotation2214014 1 Help:Barcodes range2214014 1 682 706 BBa_K115003 1 BBa_K115003 RNA thermometer (PrfA) 2008-07-14T11:00:00Z 2015-05-08T01:09:27Z This sequence is taken from the Listeria Monocytogenes (EU372032.). It's the 5'UTR of a TF induced at 37 degrees. Released HQ 2013 This part is designed as a temperature inducible RBS. Only designed so far. false false _223_ 0 3007 9 In stock true The secondary structure is important to the function of these regions, but part of the wt secondary structure is destroyed by the scar. We've tried to alter the sequence so the predicted structure (through mfold and those kind of servers) is sort of conserved, but temperature sensitivity still has to be tested. If it doesn't work, possible solution might be the addition of a larger conserved part of the wt, which implies a small part of wt protein sequence as well. true O.M.J.A. Stassen annotation1967003 1 Predicted stem loop up to A of AUG range1967003 1 28 109 annotation1966983 1 SD range1966983 1 106 109 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1679012 1 BBa_K1679012 promoter+RNA thermometer+RFP 2015-09-07T11:00:00Z 2015-09-18T09:15:45Z BBa_J23106 BBa_K115003 BBa_E1010 This is a device containing a promoter(BBa_J23106),a RBS(BBa_K115003) and a RFP coding sequence(BBa_E1010) on the pSB1C3 ,which can be easily transformed into E.coli.Then the E.coli would produce RFP when the temperature rises above 37??C. false false _2097_ 25071 25070 9 false We use a special RBS(BBa_K115003) to make the device temperature-sensitive.When the temperature is below 37??C,the secondary structure of the RBS after transform would be folded.Thus the ribosome can't translated RFP.However,when the temperature rises above 42??C,the secondary structure of the RBS after transform would be unfolded and produce RFP. false Cun Wei component2467135 1 BBa_J23106 component2467138 1 BBa_K115003 component2467141 1 BBa_E1010 annotation2467141 1 BBa_E1010 range2467141 1 159 864 annotation2467138 1 BBa_K115003 range2467138 1 44 152 annotation2467135 1 BBa_J23106 range2467135 1 1 35 BBa_K115003_sequence 1 tgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattggggga BBa_E1010_sequence 1 atggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_K1679012_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagtgtaaaaaatattatttagcgtgactttctagtaacagctaacaattgttgttactgcctaatgtttttagggtattttaaaaaagggcgataaaaaacgattgggggatactagatggcttcctccgaagacgttatcaaagagttcatgcgtttcaaagttcgtatggaaggttccgttaacggtcacgagttcgaaatcgaaggtgaaggtgaaggtcgtccgtacgaaggtacccagaccgctaaactgaaagttaccaaaggtggtccgctgccgttcgcttgggacatcctgtccccgcagttccagtacggttccaaagcttacgttaaacacccggctgacatcccggactacctgaaactgtccttcccggaaggtttcaaatgggaacgtgttatgaacttcgaagacggtggtgttgttaccgttacccaggactcctccctgcaagacggtgagttcatctacaaagttaaactgcgtggtaccaacttcccgtccgacggtccggttatgcagaaaaaaaccatgggttgggaagcttccaccgaacgtatgtacccggaagacggtgctctgaaaggtgaaatcaaaatgcgtctgaaactgaaagacggtggtcactacgacgctgaagttaaaaccacctacatggctaaaaaaccggttcagctgccgggtgcttacaaaaccgacatcaaactggacatcacctcccacaacgaagactacaccatcgttgaacagtacgaacgtgctgaaggtcgtcactccaccggtgcttaataacgctgatagtgctagtgtagatcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z