BBa_K1679026 1 BBa_K1679026 pT7-21 + RiboJ + GFP + LVA + 3 terminnators 2015-09-16T11:00:00Z 2015-09-18T08:09:28Z Synthesized by Genewize. This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. The four T7 RNA polymerases are a family with different activity, the T7 RNA polymerase in this device have approximate relative activity 21%. false false _2097_ 25072 25072 9 true This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. We added restriction sites flank these segments, so that users can change this segments into what they prefer. Users can replace T7 with other promoters through SalI and HindIII; replace RiboJ and GFP with other coding sequence through HindIII and StuI. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme which can excise its upstream fragment to reduce noise, and an additional 23-nt hairpin immediately downstream to help expose the RBS. We use it to buffer synthetic circuits from genetic context. To adapt the protein expression device, three terminators are design to use cooperatively with strong promoters, the LVA degradation tag can accelerate protein degradation rate to decrease cell stress. false Xihan Zhang annotation2469901 1 T7 terminator range2469901 1 223 270 annotation2469902 1 LVA range2469902 1 293 334 annotation2469905 1 RiboJ range2469905 1 1074 1148 annotation2469899 1 rrnB T2 terminator range2469899 1 18 45 annotation2469904 1 rbs range2469904 1 1058 1062 annotation2469900 1 rrnB T1 terminator range2469900 1 128 214 annotation2469903 1 GFP range2469903 1 335 1048 annotation2469906 1 T7-21 promoter range2469906 1 1155 1172 BBa_K1679026_sequence 1 gaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttattgctcagcggtggcagcattaagccaccagtgcgtagttttcatcgttagcagcaggccttttatacagttcgtccatgccgtgggtgatacccgcagccgtcacaaattccagcaggaccatgtggtcacgtttttcgttcggatcttttgacagcacggactgggtactcaggtagtgattgtccggcagcaggaccgggccatcaccaatcggcgtgttttgctgatagtggtcggccagctgaacgctaccatcttccacattatggcggattttgaaattggctttaatgccgtttttctgtttatccgcggtgatgtacacgttgtgggaattgaagttatattccagtttatgacccagaatattgccgtcttctttgaaatcgatacctttcagttcgatacggttaaccagggtatcgccttcgaatttcacttccgcgcgggttttatacgtaccatcgtctttaaagctaatcgtacgttcctgcacatagccttccggcatggccgatttgaaaaagtcgtgctgtttcatgtgatccgggtaacgcgcaaaacattgaacgccataggtcagcgtggtcaccagcgtcggccacgggaccggcagtttacccgtggtgcagataaatttcagggtcagtttgccgttcgtcgcatcgccttcaccttcgccgcgaacactgaatttatgaccattaacatcgccgtccagttccaccagaatcggaaccacaccggtaaacagttcttcgcctttacgcatatgtatatctccttcttaaagttaattaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagctaagcttctacagtgagtcgtattagtcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z