BBa_K1679029 1 BBa_K1679029 ftnA 2015-09-16T11:00:00Z 2015-09-18T07:46:27Z We acquired this part from genomic of E.coli K-12 Top10 by PCR. FtnA is a bacterial ferritin with a protein shell is assembled from 24 identical 19.4 kDa FtnA monomers. Its central cavity is around 7.5 nm in diameter and can be loaded with iron when cells grow under iron-rich conditions[1]. The iron is stored in the form of ferrihydrite iron cores normally that with superparamagnetic properties[2]. The iron contained ferritin can generate heat in response to electromagnetic signal[3]. For the reasons above, we design it as our magnetic receiver which can turn electromagnetic signal into heat. [1]Smith J L. The physiological role of ferritin-like compounds in bacteria[J]. Critical reviews in microbiology, 2004, 30(3): 173-185. [2] Papaefthymiou G C, Viescas A J, Devlin E, et al. Electronic and magnetic characterization of in vivo produced vs. in vitro reconstituted horse spleen ferritin[C]//MRS Proceedings. Cambridge University Press, 2007, 1056: 1056-HH03-27. [3] Stanley S A, Sauer J, Kane R S, et al. Remote regulation of glucose homeostasis in mice using genetically encoded nanoparticles[J]. Nature medicine, 2015, 21(1): 92-98. false false _2097_ 25072 25072 9 true We chose ftnA as our magnetic receiver which can be heated by electromagnetic signal and used cooperatively with our thermo-regulators to control the expression of downstream genes. false Jinyang Liang BBa_K1679029_sequence 1 atgattgaaaaacttaatgagcagatgaacctggaactgtactcttcactgctttatcagcaaatgagcgcctggtgcagctatcataccttcgaaggtgctgccgcgttcctgcgccgtcacgcccaggaagagatgacgcatatgcagcgtctgtttgattacctgactgataccggcaatttaccgcgtattaataccgttgaatctccgtttgctgaatattcctcacttgatgaattattccaggaaacctataaacacgaacaattaatcacccagaaaattaacgaactggctcatgctgcaatgaccaatcaggactacccaacatttaatttcctgcaatggtatgtttctgagcagcatgaagaagagaaactgttcaaatcgattattgataaattaagcctggcaggcaaaagcggcgaaggtctgtattttatcgacaaagaactctctaccctcgacacacaaaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z