BBa_K1679039 1 BBa_K1679039 pT7-10 + RiboJ + GFP + LVA + 3 terminnators 2015-09-16T11:00:00Z 2015-09-17T09:03:49Z Synthesized by Genewiz. This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. The four T7 RNA polymerases are a family with different activity, the T7 RNA polymerase in this device have approximate relative activity 10%. false false _2097_ 25072 25072 9 false This device is design for protein expression and promoter measurement. It constructed with a T7 RNA polymerase which has other 3 mutations, a RiboJ, a green fluorescent protein, a LVA degradation tag, a T7 terminator, a rrnB T1 terminator and a rrnB T2 terminator. We added restriction sites flank these segments, so that users can change this segments into what they prefer. Users can replace T7 with other promoters through SalI and HindIII; replace RiboJ and GFP with other coding sequence through HindIII and StuI. After transcription, RiboJ becomes a section of functional RNA which comprises the sTRSV- ribozyme which can excise its upstream fragment to reduce noise, and an additional 23-nt hairpin immediately downstream to help expose the RBS. We use it to buffer synthetic circuits from genetic context. To adapt the protein expression device, three terminators are design to use cooperatively with strong promoters, the LVA degradation tag can accelerate protein degradation rate to decrease cell stress. false Xihan Zhang annotation2469908 1 rrnB T1 terminator range2469908 1 128 214 annotation2469911 1 GFP range2469911 1 335 1048 annotation2469910 1 LVA range2469910 1 293 334 annotation2469914 1 T7-10 promoter range2469914 1 1155 1172 annotation2469913 1 RiboJ range2469913 1 1074 1148 annotation2469907 1 rrnB T2 terminator range2469907 1 18 45 annotation2469909 1 T7 terminator range2469909 1 223 270 annotation2469912 1 rbs range2469912 1 1058 1062 BBa_K1679039_sequence 1 gaaacgcaaaaaggccatccgtcaggatggccttctgcttagtttgatgcctggcagtttatggcgggcgtcctgcccgccaccctccgggccgttgcttcacaacgttcaaatccgctcccggcggatttgtcctactcaggagagcgttcaccgacaaacaacagataaaacgaaaggcccagtcttccgactgagcctttcgttttatttgatgcctggcaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttattgctcagcggtggcagcattaagccaccagtgcgtagttttcatcgttagcagcaggccttttatacagttcgtccatgccgtgggtgatacccgcagccgtcacaaattccagcaggaccatgtggtcacgtttttcgttcggatcttttgacagcacggactgggtactcaggtagtgattgtccggcagcaggaccgggccatcaccaatcggcgtgttttgctgatagtggtcggccagctgaacgctaccatcttccacattatggcggattttgaaattggctttaatgccgtttttctgtttatccgcggtgatgtacacgttgtgggaattgaagttatattccagtttatgacccagaatattgccgtcttctttgaaatcgatacctttcagttcgatacggttaaccagggtatcgccttcgaatttcacttccgcgcgggttttatacgtaccatcgtctttaaagctaatcgtacgttcctgcacatagccttccggcatggccgatttgaaaaagtcgtgctgtttcatgtgatccgggtaacgcgcaaaacattgaacgccataggtcagcgtggtcaccagcgtcggccacgggaccggcagtttacccgtggtgcagataaatttcagggtcagtttgccgttcgtcgcatcgccttcaccttcgccgcgaacactgaatttatgaccattaacatcgccgtccagttccaccagaatcggaaccacaccggtaaacagttcttcgcctttacgcatatgtatatctccttcttaaagttaattaaacaaaattatttgtagaggctgtttcgtcctcacggactcatcagaccggaaagcacatccggtgacagctaagcttctatagtgagtcgtcttagtcgac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z